SBB09Ntbk-Hank Shih: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
Line 1: | Line 1: | ||
'''02/09/2009'''<br> | '''02/09/2009'''<br> | ||
Finished making basic part for M10024 | Finished making basic part for M10024. This is the final construction file:<br> | ||
<pre> | |||
Construction of {a~eaeA_Display>} basic part | |||
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7 (146 bp, gp = A) | |||
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7 (1889 bp, gp = B) | |||
---------------------------- | |||
PCR Bhs001F/Bhs003R on A+B (2009 bp, EcoRI/BamHI) | |||
Digest pBca9495CA-Bca1144#5 (EcoRI/BamHI, 3039+910, L) | |||
Product is pBca9495CA-M10024 {a~eaeA_Display>} | |||
---------------------------- | |||
Bhs001F Forward EcoRI for a~eaeA_Display> cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG | |||
Bhs002F Removing the EcoRI site from eaeA_Display GTTAATCAGAACTCATTTGCAAATGG | |||
Bhs002R Removing the EcoRI site from eaeA_Display CCATTTGCAAATGAGTTCTGATTAAC | |||
Bhs003R Reverse BamHI for a~eaeA_Display> GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC | |||
</pre> |
Revision as of 11:42, 25 February 2009
02/09/2009
Finished making basic part for M10024. This is the final construction file:
Construction of {a~eaeA_Display>} basic part PCR Bhs001F/Bhs002R on E. coli strain 0157:H7 (146 bp, gp = A) PCR Bhs002F/Bhs003R on E. coli strain 0157:H7 (1889 bp, gp = B) ---------------------------- PCR Bhs001F/Bhs003R on A+B (2009 bp, EcoRI/BamHI) Digest pBca9495CA-Bca1144#5 (EcoRI/BamHI, 3039+910, L) Product is pBca9495CA-M10024 {a~eaeA_Display>} ---------------------------- Bhs001F Forward EcoRI for a~eaeA_Display> cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG Bhs002F Removing the EcoRI site from eaeA_Display GTTAATCAGAACTCATTTGCAAATGG Bhs002R Removing the EcoRI site from eaeA_Display CCATTTGCAAATGAGTTCTGATTAAC Bhs003R Reverse BamHI for a~eaeA_Display> GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC