SBB09Ntbk-Hank Shih: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 1: Line 1:
'''02/09/2009'''<br>
'''02/09/2009'''<br>
Finished making basic part for M10024
Finished making basic part for M10024. This is the final construction file:<br>
<pre>
Construction of {a~eaeA_Display>} basic part
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7    (146 bp, gp = A)
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7    (1889 bp, gp = B)
----------------------------
PCR Bhs001F/Bhs003R on A+B                      (2009 bp, EcoRI/BamHI)
Digest pBca9495CA-Bca1144#5                      (EcoRI/BamHI, 3039+910, L)
Product is pBca9495CA-M10024                    {a~eaeA_Display>}
----------------------------
Bhs001F  Forward EcoRI for a~eaeA_Display>          cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
Bhs002F  Removing the EcoRI site from eaeA_Display  GTTAATCAGAACTCATTTGCAAATGG
Bhs002R  Removing the EcoRI site from eaeA_Display  CCATTTGCAAATGAGTTCTGATTAAC
Bhs003R  Reverse BamHI for a~eaeA_Display>          GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC
</pre>

Revision as of 11:42, 25 February 2009

02/09/2009
Finished making basic part for M10024. This is the final construction file:

Construction of {a~eaeA_Display>} basic part
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7     (146 bp, gp = A)
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7     (1889 bp, gp = B)
----------------------------
PCR Bhs001F/Bhs003R on A+B                       (2009 bp, EcoRI/BamHI)
Digest pBca9495CA-Bca1144#5                      (EcoRI/BamHI, 3039+910, L)
Product is pBca9495CA-M10024                     {a~eaeA_Display>}
----------------------------
Bhs001F  Forward EcoRI for a~eaeA_Display>           cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
Bhs002F  Removing the EcoRI site from eaeA_Display   GTTAATCAGAACTCATTTGCAAATGG
Bhs002R  Removing the EcoRI site from eaeA_Display   CCATTTGCAAATGAGTTCTGATTAAC
Bhs003R  Reverse BamHI for a~eaeA_Display>           GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC