SBB09Ntbk-Hank Shih

02/09/2009
Finished making basic part for M10024. This is the final construction file:

Construction of {a~eaeA_Display>} basic part
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7     (146 bp, gp = A)
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7     (1889 bp, gp = B)
----------------------------
PCR Bhs001F/Bhs003R on A+B                       (2009 bp, EcoRI/BamHI)
Digest pBca9495CA-Bca1144#5                      (EcoRI/BamHI, 3039+910, L)
Product is pBca9495CA-M10024                     {a~eaeA_Display>}
----------------------------
Bhs001F  Forward EcoRI for a~eaeA_Display>           cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
Bhs002F  Removing the EcoRI site from eaeA_Display   GTTAATCAGAACTCATTTGCAAATGG
Bhs002R  Removing the EcoRI site from eaeA_Display   CCATTTGCAAATGAGTTCTGATTAAC
Bhs003R  Reverse BamHI for a~eaeA_Display>           GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC

02/18/2009
Today, I've setup my first two PCR reactions with Bhs001F/Bhs002R and Bhs002F/Bhs003R. The standard protocol was followed. The mixture was composed of the following:

24uL ddH2O
3.3uL 10x Expand Buffer "2"
3.3uL dNTPs (2mM in each)
1uL Oligo 1, 10uM
1uL Oligo 2, 10uM
0.5uL Expand polymerase "1"
0.5uL Template DNA

The Bhs001F/Bhs002R PCR had an expected product of 146bp and was ran on the 55 program. The Bhs002F/Bhs003R PCR had an expected product of 1889bp and was ran on the 2K55 program.

02/23/2009
Today, I got both PCR products back. In order to proceed to the next step, I need to gel purify my PCR products. This was also a great time to see if the PCR products came out as expected.

To setup my gel, I've mixed 5uL of PCR product with 5 uL of loading buffer. This was a change from protocol because the loading buffer looked quite diluted. This mixture was loaded into the 1% agarose gel. The following picture is the results:

The gel indicates the products are within the expected range of BPs. After confirming this, I proceeded with gel purifying the PCR products. In order to do this, I followed the Zymo Gel Purification protocol:

Zymo Gel Purification

    * All spins until the drying step are 15 second full speed spins. 

   1. cut out bands minimizing extra gel matter.
   2. put in ependorf tube and add 600uL of Zymo ADB buffer (brown bottle).
   3. heat at 55, shake and/or vortex until the gel has dissolved.
   4. If the DNA is <300bp add 250uL of isopropanol
   5. transfer into the Zymo column inside a collection tube (small clear guys)
   6. spin through, discard waste.
   7. Add 200 uL of PE buffer (which is basically 70% ethanol)
   8. spin through, discard waste.
   9. Add 200 uL of PE buffer
  10. spin through, discard waste.
  11. spin for 90 seconds, full speed to dry.
  12. elute with 8.5 uL of water into a fresh Eppendorf tube 

No deviations were made from the protocol. Unfortunately, I ran out of time to setup the second PCR reaction.

02/25/2009
The goal for today is to setup my second PCR reaction. I've already gel-purified and obtained PCR product A and B on Monday. These two products will be my DNA template for this PCR reaction. For this PCR, I will be using oligos Bhs001F/Bhs003R. The PCR mixture was as followed:

24uL ddH2O
3.3uL 10x Expand Buffer "2"
3.3uL dNTPs (2mM in each)
1uL Oligo 1, 10uM
1uL Oligo 2, 10uM
0.5uL Expand polymerase "1"
0.5uL Template DNA

In order to get the 0.5uL of template DNA, I've mixed 1uL of PCR product A with 1uL of PCR product B before extracting 0.5uL of the mixture.