
From OpenWetWare

Revision as of 14:55, 9 March 2009 by David De Renzy (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search


David De Renzy 14:34, 4 February 2009 (EST)

Edit personal page
Make wiki notebook

David De Renzy 14:53, 18 February 2009 (EST)

  • Reconstituted oligos to 100μM
  • Ran basic PCR cloning reaction
  • PCR Odd001F/Odd002R on E. Coli plasmid pAPEC-1 (AF218073) (1603 bp, EcoRI/BamHI
  • Into PCR tube labeled M10040
    • Odd001F Forward EcoRI oligo for TshA ccataGAATTCatgAGATCTacacttttacctgtatacg
    • Odd002R Reverse BamHI oligo for TshA ctgatGGATCCtcagaatgaataacgaatattagcg


  • PCR Odd003F/BBa_G00101 on pBca1256-Bca1346 (3722 bp, EcoRI/BamHI)
  • Into PCR tube labeled M10041
    • Odd003F Forward oligo for INP ccaaaGAATTCatgAGATCTtgtaATGaatctcgacaaggcg
    • BBa_G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc

 Next step -> Run Analytical Gel

David De Renzy 15:38, 23 February 2009 (EST)

  • Ran Analytical gel on M10040 & M10041
    • 5μL PCR product + 5μL blue loading buffer (concentration was weak)
  • Both expected products were present
    • M10041 had a small fragment (~1000bp) of unknown DNA


  • Performed Zymo clean-up on M10040 & M10041
    • Eluted final products into 33μL water

Digest and gel purify M10040 & M10041
Maybe, run another analytical gel & purify with remaining "zymo-cleaned" M10041
Run a more stringent PCR for M10041 with higher annealing temperatures

David De Renzy 14:21, 25 February 2009 (EST)

  • Digested M10040 & M10041
    • Used 8μL of each PCR product for digest
  • Gel purified M10040 & M10041 Digests
  • Also gel purified 15μL of M10040 PCR product (after zymo clean-up)


David De Renzy 14:58, 27 February 2009 (EST)

  • Performed ligation of EcoRI/BamHI digests for pBca9495KC-M10040 & pBca9495CA-M10041
  • Transformed ligation products into E. coli cells
    • Plated pBca9495CA-M10041 transformed cells onto a CA (ampicillin) selective plate
    • Plated pBca9495KC-M10040 transformed cells onto a KC (Kanamycin) selective plate

Next-Pick colonies

David De Renzy 14:14, 2 March 2009 (EST)

  • Sources of Error:
    • No gel purification was performed after digestion
    • For pBca9495CA vector, proper extended incubation period at 37°C for 40 mins was not performed
  • Started back at digestion step
    • Used M10040 Product after Zymo cleanup
    • Used M10041 product after Zymo cleanup and gel purification (to remove 1kb unwanted fragment
  • Gel purification
    • column1=M10040, column2=M10041, column3=Ladder
    • Cut out gels were each place in 600μL of ADB buffer in labeled eppendorf tubes

Next-> finish gel purification
Maybe start ligation/transformation

David De Renzy 14:24, 4 March 2009 (EST)

  • Zymo gel purification of M10040 & M10041 completed
    • eluted into 8.5μL of ddH20 for each
    • Performed ligation of EcoRI/BamHI digests for pBca9495KC-M10040 & pBca9495CA-M10041
  • Transformed ligation products into E. coli cells
    • Performed 40 min shake & incubation at 37°C with 100μL LB added for both products
    • Plated pBca9495CA-M10041 transformed cells onto a CA (ampicillin) selective plate
    • Plated pBca9495KC-M10040 transformed cells onto a KC (Kanamycin) selective plate
  • Note: Amp=Red, K=green, C=blue

Next-pick colonies

David De Renzy 13:13, 6 March 2009 (EST)

  • ~20 colonies on pBca9495KC-M10040 plate
    • 2 colonies were already picked and incubated overnight by the GSI's
    • Minipreped and eluted with 50μL of water
    • Loaded sequencing plates: Plate1=H3 (M10040 MP clone1) & Plate2=A2(M10040 MP clone2)
  • NO COLONIES pBca9495CA-M10041 plate!
    • This part will have to be abandoned

Next- Mapping, wait for sequencing results

David De Renzy 15:55, 9 March 2009 (EDT)

  • Digested and mapped M10040 clone 1 and clone 2


Personal tools