Registry/Measurement kit/Notebook/2007-7-2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 10: Line 10:
==Sequence check of I2057==
==Sequence check of I2057==
*dnalims.mit.edu
*dnalims.mit.edu
*Mix for sequencing rxn
**1uL DNA (200-500 ng)
**1uL DNA (200-500 ng)
**2uL 1.6 uM VF2/VR
**2uL 1.6 uM VF2/VR

Revision as of 12:47, 2 July 2007

Key

  • I2055 - GFP RBS tester
  • I2056 - RFP RBS tester (blue)
  • I2057 - RFP promoter tester (green)

Retransformation of I2057

  • Used previous ligation (tet and chlor)
  • Plated 200uL

Sequence check of I2057

  • dnalims.mit.edu
  • Mix for sequencing rxn
    • 1uL DNA (200-500 ng)
    • 2uL 1.6 uM VF2/VR
    • 9uL H2O

Scarring PCR

  • Gradient PCR of I2055 from 41 to 51 deg
  • PCR of T9002 with Tm of 54.5 deg

Primer Design

To insert BB sites:

  • For E0240:
    • F (incl E0240): tail (PstI) + TCACACAGGAAAGTACTAGATGCG
    • R (incl 3K3): tail (EcoRI) + AATTCCAGAAATCATCCTTAGCG
  • For I2055:
    • F (incl GFP): tail (speI) + ATGCGTAAAGGAGAAGAACTTTTC
    • R (incl R0040): tail (ecorI) + GTGCTCAGTATCTCTATCACTGATAGG