Recombineering/Lambda red-mediated gene replacement

From OpenWetWare

< Recombineering
Revision as of 20:51, 5 March 2007 by ShawnDouglas (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Contents

Overview

Single-gene knockouts using λ red system, adapted from Datsenko and Wanner paper. The goal of this protocol was to create an endA (coding for endonuclease I) knockout, but obviously it can be adapted to any gene. The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol. In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.

Materials

  • plasmids
    • pKD46
    • pKD3 (chloramphenicol)
    • pKD4 (kanamycin)
    • pCP20 (optional)
  • reagents
    • L-arabinose
  • equipment
    • incubators (30[[:Category:{{{1}}}|{{{1}}}]] and 37[[:Category:{{{1}}}|{{{1}}}]])
    • electroporator

Procedure

  • Grow up pKD46, pKD3, and pCP20 in current host strains
  • Perform minipreps to extract plasmids
  • Transform pKD46 into target strain
  • PCR amplify linear fragment from pKD3 using oligos A and B (see below for design)
  • Make target strain (now maintaining pKD46) electrocompetent by growing at 30[[:Category:{{{1}}}|{{{1}}}]] with L-arabinose
  • Electroprate linear DNA into electrocompetent cells
  • Grow at 37[[:Category:{{{1}}}|{{{1}}}]] on chloramphenicol plates
  • PCR verify the deletion with oligos C and D (see below for design)

Notes

Designing necessary primers

  • First look at the sequence of the plasmid containing the resistance marker you wish to swap in for your target gene.
    • NCBI sequence viewer: pKD3
      • priming site 1: GTGTAGGCTGGAGCTGCTTC
      • priming site 2: GGACCATGGCTAATTCCCAT
      • priming site 2 reverse complement: ATGGGAATTAGCCATGGTCC


  • pKD3 CmR sequence (1033 bases)

GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCTTTAAATGGCGCGCCTTACGCCCCGCCC TGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTC GCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGA GACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTC GTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGC CATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAAT ATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGT GATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCT TACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCAC AGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCAT

  • Next, find the sequence (and context sequence) of the gene you wish to remove
    • In this example, I found the sequence and context for endA (808 bases total)
      • MG1655_m56_ABE-0009661 +50bp upstream +50bp downstream

CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGATGTACCGTTATTTGTCTATTGCTGCGGTGGTACTGAGCGCAGCATTTTCCGGC CCGGCGTTGGCCGAAGGTATCAATAGTTTTTCTCAGGCGAAAGCCGCGGCGGTAAAAGTCCACGCTGACGCGCCCGGTACGTTTTATTGCGGATGTAAAATTAA CTGGCAGGGCAAAAAAGGCGTTGTTGATCTGCAATCGTGCGGCTATCAGGTGCGCAAAAATGAAAACCGCGCCAGCCGCGTAGAGTGGGAACATGTCGTTCCCG CCTGGCAGTTCGGTCACCAGCGCCAGTGCTGGCAGGACGGTGGACGTAAAAACTGCGCTAAAGATCCGGTCTATCGCAAGATGGAAAGCGATATGCATAACCTG CAGCCGTCAGTCGGTGAGGTGAATGGCGATCGCGGCAACTTTATGTACAGCCAGTGGAATGGCGGTGAAGGCCAGTACGGTCAATGCGCCATGAAGGTCGATTT CAAAGAAAAAGCTGCCGAACCACCAGCGCGTGCACGCGGTGCCATTGCGCGCACCTACTTCTATATGCGCGACCAATACAACCTGACACTCTCTCGCCAGCAAA CGCAGCTGTTCAACGCATGGAACAAGATGTATCCGGTTACCGACTGGGAGTGCGAGCGCGATGAACGCATCGCGAAGGTGCAGGGCAATCATAACCCGTATGTG CAACGCGCTTGCCAGGCGCGAAAGAGCTAACCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC

  • Construct primers that have internal overlap with the resistance marker (pKD3) and external overlap with the target knockout gene (endA).
    • Forward primer: A
      • CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTC
    • Reverse primer: B
      • GGTTGTACGCGTGGGGTAGGGGTTAACAAAAAGAATCCCGCTAGTGTAGGATGGGAATTAGCCATGGTCC
  • Construct primers that only flank the target gene (endA) for PCR verification
    • Forward primer: C
      • CCAAAACAGCTTTCGCTACGTTGCT (25 bases)
    • Reverse primer: D
      • GGTTGTACGCGTGGGGTAGGGGTTA (25 bases)
  • Figure out the sequence and size of what you should expect if everything works. In this case, it's CmR inserted into endA flanking region (1132 bases total)

CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTC GGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGCATGGAAGCCATCACAAA CGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGC CACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAAC ACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAA CAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGG ATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAA ATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAA TACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTAT CAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGG AACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCATCCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC



References

λ red Links

endA Links

  1. Datsenko KA and Wanner BL. . pmid:10829079. PubMed HubMed [Datsenko-PNAS-2000]

Contact

  • Shawn Douglas — posted original protocol, performed once in August 2006.
Personal tools