Recombineering/Lambda red-mediated gene replacement

	back to protocols

Overview

Single-gene knockouts using λ red system, adapted from Datsenko and Wanner paper. The goal of this protocol was to create an endA (endonuclease I) knockout, but obviously it can be adapted to any gene. The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol. In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.

Since the λ red system can introduce unintended mutations, often people move the knockout to a fresh strain after it is verified. P1 transduction can be used to do this.

Materials

Not a complete list — see protocol for details, or update this list --smd 20:20, 5 March 2007 (EST)

• plasmids
  • pKD46
    • pKD46 carries the λ red genes behind the araBAD promoter & is temperature sensitive (grow at <= 32 °C to maintain the plasmid). Use Ampicillin.
  • pKD3 (chloramphenicol) or pKD4 (kanamycin)
    • pKD3 = chloramhenicol resistance cassette. Require the pir gene product for replication, which means that a carry-over of the plasmids (and false positives) is not possible. The resistance cassettes is flanked by FRT sites, which allow the removal of the cassettes once inserted in the bacterial chromosome with a FLP helper plasmid.
      • pKD4 = kanamycin resistance version, if needed instead.
  • pCP20 (optional)
    • pCP20 contains a temperature-inducible flp gene for removing the chloramphenicol resistance gene you will introduce. Also confers ampicillin & chloramphenicol resistance.
• reagents
  • L-arabinose
• equipment
  • incubators (30°C and 37°C)
  • electroporator

Procedure

• General outline
  • Grow up pKD46, pKD3, and pCP20 in host strains
    • pKD46 should be grown at <= 32oC to maintain the temperature sensitive plasmid.
  • Perform minipreps to extract plasmids
  • Transform pKD46 into target strain, plate out on LB-amp plates
  • PCR amplify linear fragment from pKD3 or pKD4 using oligos A and B (see below for design)
  • Make target strain (now maintaining pKD46) electrocompetent by growing at 30°C with L-arabinose
  • Electroprate linear DNA into electrocompetent cells
  • Grow at 37°C on chloramphenicol plates
  • PCR verify the deletion with oligos C and D (see below for design)
• Detailed procedure
• Day 0: Start overnight culture
  • Start overnight culture of strain containing gene to knock out.
• Day 1: Preparation and transformation of competent cells
  • Make new glycerol stock of overnight strain (grown from single colony)
  • Add 300 μL overnight culture to 30 mL LB medium (1:100 dilution)
  • Check culture density every 30 minutes starting at +1 hour; grow to OD₆₀₀ of 0.3 to 0.4
  • OD₆₀₀ measurements of K91
    • +2:00 hrs: 0.06
    • +2:45 hrs: 0.3008
  • Spin at 2500rcf for 10 minutes at 4°C in two 50 mL centrifuge tubes (JA-20 rotor)
  • Decant supernatant, discard
  • Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix
    • Transformation Buffer
    • 10 mM Pipes
    • 15 mM CaCl₂
    • 250 mM KCl
    • Titrate to pH 6.7 before adding MnCl₂
    • 55 mM MnCl₂
    • Filter sterilize
  • Incubate on ice for 10 min
  • Spin at 2500rcf for 10 minutes at 4°C
  • Decant supernatant, discard
  • Resuspend each pellet in 1.25 mL ice cold transformation buffer
  • Combine resuspended pellets in single tube
  • Remove 400 μL for immediate transformation
  • Add DMSO to a final concentration of 7% (160 μL). Drip the DMSO slowly into the cell suspension, with constant swirling by hand.
  • Incubate on ice for 10 min
  • Aliquot 400 μL each into five 1.5 mL tubes
  • Store in -80°C freezer.
  • Transform strain with pKD46 and grow on LB-amp plate at 30°C
    • Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
    • Add 100 μL of competent cell mix to each tube
    • Incubate on ice 30 min
    • Heat shock 30 seconds at 42°C
    • Incubate on ice 2 min
    • Spread all 100 μL on LB-amp-kan plate
    • Incubate at 30°C overnight
  • U45endA—pKD3[Cat]—D45endA fragment is chloramphenicol cassette with FRT sequences, flanked by 45 bp upstream and downstream of endA.
  • PCR U45endA— pKD3[Cat]—D45endA from pKD3 and verify on gel
    • PCR program: 95°C 7min → 35*[94°C 15s → 50°C 30s → 72°C 90s]

Contents	Concentration	Volume
pKD3 template	45 ng/μL	0.5 μL
forward primer	10 μM	5 μL
reverse primer	10 μM	5 μL
10x KOD buffer	-	10 μL
dNTP	2 mM	10 μL
MgSO4	25 mM	4 μL
KOD polymerase		2 μL
dH2O	-	64.5 μL

• • Make ten 10 μg/ml chloramphenicol plates and ten 25 μg/ml chloramphenicol plates

• Day 2
  • Make 1 M stock of L-arabinose
    • MW of L-arabinose is 150.13
    • Add 1501.3 mg of L-arabinose to 8.5 g dH₂O to make 1 M stock
  • Retrieve plates from incubator
  • Check results from the transformation
    • 1 ng pKD46 transformation yielded about 10 colonies
    • 10 ng pKD46 transformation yielded about 100 colonies
    • 100 ng pKD46 transformation yielded several hundred colonies
  • Pick some colonies and grow at 30°C in 2 mL LB + 50 μg/mL Amp
    • add 50 μL 10 mg/mL Ampicillin stock
  • Include enough samples for two conditions: +/- L-arabinose induction
  • When OD₆₀₀ of cells(+pKD46) reaches 0.1, add L-arabinose to concentration of 10 mM to induce pKD46 λ-red expression
    • add 20 μL 1 M L-arabinose to 2 mL culture
  • Continue to grow at 30°C to OD₆₀₀ = 0.4
  • Aliquot 1 mL each into two 1.5 mL centrifuge tubes
  • Chill cells in ice-water bath 10 minutes
  • Centrifuge 10 min at 4000rcf 4°C
  • Pipette off supernatant and resuspend pellets in 1 mL ice-cold dH₂O
  • Centrifuge 10 min at 4000rcf 4°C
  • Resuspend pellet in 50 μL dH₂O
  • For electroporation step, include 2 conditions: +/- PCR fragment
  • Chill electroporation cuvettes for 5 minutes on ice
  • Add 5 pg to 0.5 μg PCR amplified DNA to cells
  • Set electroporation apparatus to 2.5 kV, 25 μF. Set the pulse controller to 200 ohms
  • Place the cuvette into the sample chamber
  • Apply the pulse by pushing the button
  • Remove the cuvette. Immediately add 1 mL LB medium and transfer to a sterile culture tube
  • Incubate 60-120 min with moderate shaking at 37°C
  • Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 μg/mL, 25 μg/mL)

Notes

Designing necessary primers

• First look at the sequence of the plasmid containing the resistance marker you wish to swap in for your target gene.
  • NCBI sequence viewer: pKD3
    • priming site 1: GTGTAGGCTGGAGCTGCTTC
    • priming site 2: GGACCATGGCTAATTCCCAT
    • priming site 2 reverse complement: ATGGGAATTAGCCATGGTCC

• pKD3 Cat sequence (1034 bases)

GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCC TGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTC GCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGA GACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTC GTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGC CATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAAT ATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGT GATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCT TACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCAC AGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCAT

• Next, find the sequence (and context sequence) of the gene you wish to remove
  • In this example, I found the sequence and context for endA (808 bases total)
    • MG1655_m56_ABE-0009661 +50bp upstream +50bp downstream

CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGATGTACCGTTATTTGTCTATTGCTGCGGTGGTACTGAGCGCAGCATTTTCCGGC CCGGCGTTGGCCGAAGGTATCAATAGTTTTTCTCAGGCGAAAGCCGCGGCGGTAAAAGTCCACGCTGACGCGCCCGGTACGTTTTATTGCGGATGTAAAATTAA CTGGCAGGGCAAAAAAGGCGTTGTTGATCTGCAATCGTGCGGCTATCAGGTGCGCAAAAATGAAAACCGCGCCAGCCGCGTAGAGTGGGAACATGTCGTTCCCG CCTGGCAGTTCGGTCACCAGCGCCAGTGCTGGCAGGACGGTGGACGTAAAAACTGCGCTAAAGATCCGGTCTATCGCAAGATGGAAAGCGATATGCATAACCTG CAGCCGTCAGTCGGTGAGGTGAATGGCGATCGCGGCAACTTTATGTACAGCCAGTGGAATGGCGGTGAAGGCCAGTACGGTCAATGCGCCATGAAGGTCGATTT CAAAGAAAAAGCTGCCGAACCACCAGCGCGTGCACGCGGTGCCATTGCGCGCACCTACTTCTATATGCGCGACCAATACAACCTGACACTCTCTCGCCAGCAAA CGCAGCTGTTCAACGCATGGAACAAGATGTATCCGGTTACCGACTGGGAGTGCGAGCGCGATGAACGCATCGCGAAGGTGCAGGGCAATCATAACCCGTATGTG CAACGCGCTTGCCAGGCGCGAAAGAGCTAACCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC

• Construct primers that have internal overlap with the resistance marker (pKD3) and external overlap with the target knockout gene (endA).
  • Forward primer: A
    • CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTC
  • Reverse primer: B
    • GGTTGTACGCGTGGGGTAGGGGTTAACAAAAAGAATCCCGCTAGTGTAGGATGGGAATTAGCCATGGTCC

• Construct primers that only flank the target gene (endA) for PCR verification
  • Forward primer: C
    • CCAAAACAGCTTTCGCTACGTTGCT (25 bases)
  • Reverse primer: D
    • GGTTGTACGCGTGGGGTAGGGGTTA (25 bases)

• Figure out the sequence and size of what you should expect if everything works. In this case, it's Cat inserted into endA flanking region (1132 bases total)

CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTC GGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGCATGGAAGCCATCACAAA CGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCC ACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACA CGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAAC AAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGA TAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAA ATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAA ATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTA TCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAG GAACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCATCCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC

References

Literature

1. Datsenko KA and Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000 Jun 6;97(12):6640-5. DOI:10.1073/pnas.120163297 |

λ red Links

• Schematic Overview
• Protocol from Charlie Kim

endA Links

• Entrez Gene: endA
• ASAP annotation for K12 endA

Contact

• Shawn Douglas — posted original protocol, performed once in August 2006.