Recombineering/Lambda red-mediated gene replacement

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(References)
Line 210: Line 210:
*[[User:ShawnDouglas|Shawn Douglas]] — posted original protocol, performed once in August 2006.
*[[User:ShawnDouglas|Shawn Douglas]] — posted original protocol, performed once in August 2006.
-
[[Category:Protocol]]
+
[[Category:Protocol]] [[Category:Escherichia coli]]

Revision as of 12:43, 20 April 2007

Contents

Overview

Single-gene knockouts using λ red system, adapted from Datsenko and Wanner paper. The goal of this protocol was to create an endA (endonuclease I) knockout, but obviously it can be adapted to any gene. The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol. In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.

Materials

Not a complete list — see protocol for details, or update this list :) --smd 20:20, 5 March 2007 (EST)

  • plasmids
    • pKD46
    • pKD3 (chloramphenicol)
    • pKD4 (kanamycin)
    • pCP20 (optional)
  • reagents
    • L-arabinose
  • equipment
    • incubators (30[[:Category:{{{1}}}|{{{1}}}]] and 37[[:Category:{{{1}}}|{{{1}}}]])
    • electroporator

Procedure

  • Geneeral outline
    • Grow up pKD46, pKD3, and pCP20 in current host strains
    • Perform minipreps to extract plasmids
    • Transform pKD46 into target strain
    • PCR amplify linear fragment from pKD3 using oligos A and B (see below for design)
    • Make target strain (now maintaining pKD46) electrocompetent by growing at 30[[:Category:{{{1}}}|{{{1}}}]] with L-arabinose
    • Electroprate linear DNA into electrocompetent cells
    • Grow at 37[[:Category:{{{1}}}|{{{1}}}]] on chloramphenicol plates
    • PCR verify the deletion with oligos C and D (see below for design)
  • Detailed procedure
    • This was my first attempt at this protocol, and I left out some of the proper controls. Feel free to fix anything that seems erroneous. --smd 20:21, 5 March 2007 (EST)
  • Day 0: Start overnight culture
    • Start overnight culture of strain containing gene to knock out.
  • Day 1: Preparation and transformation of competent cells
    • Make new glycerol stock of overnight strain (grown from single colony)
    • Add 300 μL overnight culture to 30 mL LB medium (1:100 dilution)
    • Check density every 30 minutes starting at +1 hour; grow to OD600 of 0.3 to 0.4
    • OD600 measurements
      • +2:00 hrs: 0.06
      • +2:45 hrs: 0.3008
    • Spin at 2500rcf for 10 minutes at 4[[:Category:{{{1}}}|{{{1}}}]] in two 50 mL centrifuge tubes (JA-20 rotor)
    • Decant supernatant, discard
    • Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix
      • Transformation Buffer
      • 10 mM Pipes
      • 15 mM CaCl2
      • 250 mM KCl
      • Titrate to pH 6.7 before adding MnCl2
      • 55 mM MnCl2
      • Filter sterilize
    • Incubate on ice for 10 min
    • Spin at 2500rcf for 10 minutes at 4[[:Category:{{{1}}}|{{{1}}}]]
    • Decant supernatant, discard
    • Resuspend each pellet in 1.25 mL ice cold transformation buffer
    • Combine resuspended pellets in single tube
    • Remove 400 μL for immediate transformation
    • Add DMSO to a final concentration of 7% (160 μL). Drip the DMSO slowly into the cell suspension, with constant swirling by hand.
    • Incubate on ice for 10 min
    • Aliquot 400 μL each into five 1.5 mL tubes
    • Store in -80[[:Category:{{{1}}}|{{{1}}}]] freezer.
    • Transform strain with pKD46 and grow on LB-amp-kan plate at 30[[:Category:{{{1}}}|{{{1}}}]]
      • Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
      • Add 100 μL of competent cell mix to each tube
      • Incubate on ice 30 min
      • Heat shock 30 seconds at 42[[:Category:{{{1}}}|{{{1}}}]]
      • Incubate on ice 2 min
      • Spread all 100 μL on LB-amp-kan plate
      • Incubate at 30[[:Category:{{{1}}}|{{{1}}}]] overnight
    • PCR endA-CmR from pKD3 and verify on gel
      • PCR program: 95[[:Category:{{{1}}}|{{{1}}}]] 7min → 20*[94[[:Category:{{{1}}}|{{{1}}}]] 15s → 50[[:Category:{{{1}}}|{{{1}}}]] 30s → 72[[:Category:{{{1}}}|{{{1}}}]] 90s]
Contents Concentration Volume
pKD3 template45 ng/μL0.5 μL
forward primer10 μM5 μL
reverse primer10 μM5 μL
10x KOD buffer-10 μL
dNTP2 mM10 μL
MgSO425 mM4 μL
KOD polymerase2 μL
dH2O-64.5 μL
  • Day 2
    • Make 1 M stock of L-arabinose
      • MW of L-arabinose is 150.13
      • Add 1501.3 mg of L-arabinose to 8.5 g dH2O to make 1 M stock
    • Retrieve plates from incubator
    • Good results from the transformation
      • 1 ng pKD46 transformation yielded about 10 colonies
      • 10 ng pKD46 transformation yielded about 100 colonies
      • 100 ng pKD46 transformation yielded several hundred colonies
    • Pick some colonies (I picked 3)
    • Grow at 30[[:Category:{{{1}}}|{{{1}}}]] in 2 mL LB + 50 μg/mL Amp
    • Make ten 10 μg/ml chloramphenicol plates and ten 10 μg/ml chloramphenicol plates
    • After about 7-8 hrs on shaker, measured OD600 of cells(+pKD46) at 1.05
    • Made 1/10, 1/20 dilutions of cultures in fresh 2 mL LB + 50 μg/mL Amp + 10 mM L-arabinose
      • Include enough samples for two conditions: +/- L-arabinose induction
        • 50 μL 10 mg/mL (=10 μg/μL) Ampicillin
        • 100 μL 1 M L-arabinose
      • Grow on shaker at 30[[:Category:{{{1}}}|{{{1}}}]]
    • Start four 2 mL LB-amp cultures using 1/100 dilution of cells (target strain +pKD46)
    • Grow at 30[[:Category:{{{1}}}|{{{1}}}]] to OD600 = 0.25
    • Add L-arabinose to concentration of 10 mM to induce pKD46 λ-red expression
      • 20 μL of 1 M L-arabinose to 2 mL culture
    • Continue at 30[[:Category:{{{1}}}|{{{1}}}]] to OD600 = 0.5
    • Aliquot 1 mL each into two 1.5 mL centrifuge tubes
    • Chill cells in ice-water bath 10 minutes
    • Centrifuge 10 min at 4000rcf 4[[:Category:{{{1}}}|{{{1}}}]]
    • Pipette off supernatant and resuspend pellets in 1 mL ice-cold dH2O
    • Centrifuge 10 min at 4000rcf 4[[:Category:{{{1}}}|{{{1}}}]]
    • Resuspend pellet in 50 μL dH2O
    • For electroporation step, include 2 conditions: +/- PCR fragment
    • Chill electroporation cuvettes for 5 minutes on ice
    • Add 5 pg to 0.5 μg DNA (PCR fragment from pKD3) to cells
    • Set electroporation apparatus to 2.5 kV, 25 μF. Set the pulse controller to 200 ohms
    • Place the cuvette into the sample chamber
    • Apply the pulse by pushing the button
    • Remove the cuvette. Immediately add 1 mL LB medium and transfer to a sterile culture tube
    • Incubate 60-120 min with moderate shaking at 37[[:Category:{{{1}}}|{{{1}}}]]
    • Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 μg/mL, 20 μg/mL)

Notes

Designing necessary primers

  • First look at the sequence of the plasmid containing the resistance marker you wish to swap in for your target gene.
    • NCBI sequence viewer: pKD3
      • priming site 1: GTGTAGGCTGGAGCTGCTTC
      • priming site 2: GGACCATGGCTAATTCCCAT
      • priming site 2 reverse complement: ATGGGAATTAGCCATGGTCC


  • pKD3 CmR sequence (1033 bases)

GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCTTTAAATGGCGCGCCTTACGCCCCGCCC TGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTC GCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGA GACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTC GTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGC CATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAAT ATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGT GATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCT TACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCAC AGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCAT

  • Next, find the sequence (and context sequence) of the gene you wish to remove
    • In this example, I found the sequence and context for endA (808 bases total)
      • MG1655_m56_ABE-0009661 +50bp upstream +50bp downstream

CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGATGTACCGTTATTTGTCTATTGCTGCGGTGGTACTGAGCGCAGCATTTTCCGGC CCGGCGTTGGCCGAAGGTATCAATAGTTTTTCTCAGGCGAAAGCCGCGGCGGTAAAAGTCCACGCTGACGCGCCCGGTACGTTTTATTGCGGATGTAAAATTAA CTGGCAGGGCAAAAAAGGCGTTGTTGATCTGCAATCGTGCGGCTATCAGGTGCGCAAAAATGAAAACCGCGCCAGCCGCGTAGAGTGGGAACATGTCGTTCCCG CCTGGCAGTTCGGTCACCAGCGCCAGTGCTGGCAGGACGGTGGACGTAAAAACTGCGCTAAAGATCCGGTCTATCGCAAGATGGAAAGCGATATGCATAACCTG CAGCCGTCAGTCGGTGAGGTGAATGGCGATCGCGGCAACTTTATGTACAGCCAGTGGAATGGCGGTGAAGGCCAGTACGGTCAATGCGCCATGAAGGTCGATTT CAAAGAAAAAGCTGCCGAACCACCAGCGCGTGCACGCGGTGCCATTGCGCGCACCTACTTCTATATGCGCGACCAATACAACCTGACACTCTCTCGCCAGCAAA CGCAGCTGTTCAACGCATGGAACAAGATGTATCCGGTTACCGACTGGGAGTGCGAGCGCGATGAACGCATCGCGAAGGTGCAGGGCAATCATAACCCGTATGTG CAACGCGCTTGCCAGGCGCGAAAGAGCTAACCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC

  • Construct primers that have internal overlap with the resistance marker (pKD3) and external overlap with the target knockout gene (endA).
    • Forward primer: A
      • CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTC
    • Reverse primer: B
      • GGTTGTACGCGTGGGGTAGGGGTTAACAAAAAGAATCCCGCTAGTGTAGGATGGGAATTAGCCATGGTCC
  • Construct primers that only flank the target gene (endA) for PCR verification
    • Forward primer: C
      • CCAAAACAGCTTTCGCTACGTTGCT (25 bases)
    • Reverse primer: D
      • GGTTGTACGCGTGGGGTAGGGGTTA (25 bases)
  • Figure out the sequence and size of what you should expect if everything works. In this case, it's CmR inserted into endA flanking region (1132 bases total)

CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTC GGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGCATGGAAGCCATCACAAA CGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGC CACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAAC ACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAA CAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGG ATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAA ATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAA TACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTAT CAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGG AACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCATCCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC



References

Literature

  1. Datsenko KA and Wanner BL. . pmid:10829079. PubMed HubMed [Datsenko-PNAS-2000]

λ red Links

endA Links

Contact

  • Shawn Douglas — posted original protocol, performed once in August 2006.
Personal tools