Recombineering/Lambda red-mediated gene replacement
From OpenWetWare
(New page: ==Overview== Single-gene knockouts using λ red system, adapted from [http://www.pnas.org/cgi/content/full/97/12/6640 Datsenko and Wanner] paper. The goal of this protocol was to create a...) |
(→Procedure) |
||
| Line 15: | Line 15: | ||
==Procedure== | ==Procedure== | ||
| - | *Grow up pKD46, pKD3, and pCP20 in current host strains | + | *'''Geneeral outline''' |
| - | *Perform minipreps to extract plasmids | + | **Grow up pKD46, pKD3, and pCP20 in current host strains |
| - | *Transform pKD46 into target strain | + | **Perform minipreps to extract plasmids |
| - | *PCR amplify linear fragment from pKD3 using oligos ''A'' and ''B'' (see below for design) | + | **Transform pKD46 into target strain |
| - | *Make target strain (now maintaining pKD46) electrocompetent by growing at 30{{c}} with L-arabinose | + | **PCR amplify linear fragment from pKD3 using oligos ''A'' and ''B'' (see below for design) |
| - | *Electroprate linear DNA into electrocompetent cells | + | **Make target strain (now maintaining pKD46) electrocompetent by growing at 30{{c}} with L-arabinose |
| - | *Grow at 37{{c}} on chloramphenicol plates | + | **Electroprate linear DNA into electrocompetent cells |
| - | *PCR verify the deletion with oligos ''C'' and ''D'' (see below for design) | + | **Grow at 37{{c}} on chloramphenicol plates |
| + | **PCR verify the deletion with oligos ''C'' and ''D'' (see below for design) | ||
| + | *'''Detailed procedure''' | ||
| + | **This was my first attempt at this protocol, and I left out many proper controls. Consider planning a little better. | ||
| + | *'''Day 0''' | ||
| + | **Start overnight culture of strain containing gene to knock out. | ||
| + | *'''Day 1: Preparation and transformation of competent cells''' | ||
| + | **Make new glycerol stock of overnight strain (grown from single colony) | ||
| + | **Add 300 {{ul}} overnight culture to 30 mL LB medium (1:100 dilution) | ||
| + | **Check density every 30 minutes starting at +1 hour; grow to {{od|600}} of 0.3 to 0.4 | ||
| + | **{{od|600}} measurements | ||
| + | ***+2:00 hrs: 0.06 | ||
| + | ***+2:45 hrs: 0.3008 | ||
| + | **Spin at 2500rcf for 10 minutes at 4{{c}} in two 50 mL centrifuge tubes (JA-20 rotor) | ||
| + | **Decant supernatant, discard | ||
| + | **Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix | ||
| + | ***'''Transformation Buffer''' | ||
| + | ***10 mM Pipes | ||
| + | ***15 mM {{cacl2}} | ||
| + | ***250 mM KCl | ||
| + | ***Titrate to pH 6.7 before adding {{mncl2}} | ||
| + | ***55 mM {{mncl2}} | ||
| + | ***Filter sterilize | ||
| + | **Incubate on ice for 10 min | ||
| + | **Spin at 2500rcf for 10 minutes at 4{{c}} | ||
| + | **Decant supernatant, discard | ||
| + | **Resuspend each pellet in 1.25 mL ice cold transformation buffer | ||
| + | **Combine resuspended pellets in single tube | ||
| + | **Remove 400 {{ul}} for immediate transformation | ||
| + | **Add DMSO to a final concentration of 7% (160 {{ul}}). Drip the DMSO slowly into the cell suspension, with constant swirling by hand. | ||
| + | **Incubate on ice for 10 min | ||
| + | **Aliquot 400 {{ul}} each into five 1.5 mL tubes | ||
| + | **Store in -80{{c}} freezer. | ||
| + | **Transform strain with pKD46 and grow on LB-amp-kan plate at 30{{c}} | ||
| + | ***Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA | ||
| + | ***Add 100 {{ul}} of competent cell mix to each tube | ||
| + | ***Incubate on ice 30 min | ||
| + | ***Heat shock 30 seconds at 42{{c}} | ||
| + | ***Incubate on ice 2 min | ||
| + | ***Spread all 100 {{ul}} on LB-amp-kan plate | ||
| + | ***Incubate at 30{{c}} overnight | ||
==Notes== | ==Notes== | ||
Revision as of 21:02, 5 March 2007
Contents |
Overview
Single-gene knockouts using λ red system, adapted from Datsenko and Wanner paper. The goal of this protocol was to create an endA (coding for endonuclease I) knockout, but obviously it can be adapted to any gene. The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol. In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.
Materials
- plasmids
- pKD46
- pKD3 (chloramphenicol)
- pKD4 (kanamycin)
- pCP20 (optional)
- reagents
- L-arabinose
- equipment
- incubators (30[[:Category:{{{1}}}|{{{1}}}]] and 37[[:Category:{{{1}}}|{{{1}}}]])
- electroporator
Procedure
- Geneeral outline
- Grow up pKD46, pKD3, and pCP20 in current host strains
- Perform minipreps to extract plasmids
- Transform pKD46 into target strain
- PCR amplify linear fragment from pKD3 using oligos A and B (see below for design)
- Make target strain (now maintaining pKD46) electrocompetent by growing at 30[[:Category:{{{1}}}|{{{1}}}]] with L-arabinose
- Electroprate linear DNA into electrocompetent cells
- Grow at 37[[:Category:{{{1}}}|{{{1}}}]] on chloramphenicol plates
- PCR verify the deletion with oligos C and D (see below for design)
- Detailed procedure
- This was my first attempt at this protocol, and I left out many proper controls. Consider planning a little better.
- Day 0
- Start overnight culture of strain containing gene to knock out.
- Day 1: Preparation and transformation of competent cells
- Make new glycerol stock of overnight strain (grown from single colony)
- Add 300 μL overnight culture to 30 mL LB medium (1:100 dilution)
- Check density every 30 minutes starting at +1 hour; grow to OD600 of 0.3 to 0.4
- OD600 measurements
- +2:00 hrs: 0.06
- +2:45 hrs: 0.3008
- Spin at 2500rcf for 10 minutes at 4[[:Category:{{{1}}}|{{{1}}}]] in two 50 mL centrifuge tubes (JA-20 rotor)
- Decant supernatant, discard
- Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix
- Transformation Buffer
- 10 mM Pipes
- 15 mM CaCl2
- 250 mM KCl
- Titrate to pH 6.7 before adding MnCl2
- 55 mM MnCl2
- Filter sterilize
- Incubate on ice for 10 min
- Spin at 2500rcf for 10 minutes at 4[[:Category:{{{1}}}|{{{1}}}]]
- Decant supernatant, discard
- Resuspend each pellet in 1.25 mL ice cold transformation buffer
- Combine resuspended pellets in single tube
- Remove 400 μL for immediate transformation
- Add DMSO to a final concentration of 7% (160 μL). Drip the DMSO slowly into the cell suspension, with constant swirling by hand.
- Incubate on ice for 10 min
- Aliquot 400 μL each into five 1.5 mL tubes
- Store in -80[[:Category:{{{1}}}|{{{1}}}]] freezer.
- Transform strain with pKD46 and grow on LB-amp-kan plate at 30[[:Category:{{{1}}}|{{{1}}}]]
- Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
- Add 100 μL of competent cell mix to each tube
- Incubate on ice 30 min
- Heat shock 30 seconds at 42[[:Category:{{{1}}}|{{{1}}}]]
- Incubate on ice 2 min
- Spread all 100 μL on LB-amp-kan plate
- Incubate at 30[[:Category:{{{1}}}|{{{1}}}]] overnight
Notes
Designing necessary primers
- First look at the sequence of the plasmid containing the resistance marker you wish to swap in for your target gene.
- NCBI sequence viewer: pKD3
- priming site 1: GTGTAGGCTGGAGCTGCTTC
- priming site 2: GGACCATGGCTAATTCCCAT
- priming site 2 reverse complement: ATGGGAATTAGCCATGGTCC
- NCBI sequence viewer: pKD3
- pKD3 CmR sequence (1033 bases)
GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCTTTAAATGGCGCGCCTTACGCCCCGCCC TGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTC GCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGA GACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTC GTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGC CATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAAT ATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGT GATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCT TACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCAC AGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCAT
- Next, find the sequence (and context sequence) of the gene you wish to remove
- In this example, I found the sequence and context for endA (808 bases total)
- MG1655_m56_ABE-0009661 +50bp upstream +50bp downstream
- In this example, I found the sequence and context for endA (808 bases total)
CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGATGTACCGTTATTTGTCTATTGCTGCGGTGGTACTGAGCGCAGCATTTTCCGGC CCGGCGTTGGCCGAAGGTATCAATAGTTTTTCTCAGGCGAAAGCCGCGGCGGTAAAAGTCCACGCTGACGCGCCCGGTACGTTTTATTGCGGATGTAAAATTAA CTGGCAGGGCAAAAAAGGCGTTGTTGATCTGCAATCGTGCGGCTATCAGGTGCGCAAAAATGAAAACCGCGCCAGCCGCGTAGAGTGGGAACATGTCGTTCCCG CCTGGCAGTTCGGTCACCAGCGCCAGTGCTGGCAGGACGGTGGACGTAAAAACTGCGCTAAAGATCCGGTCTATCGCAAGATGGAAAGCGATATGCATAACCTG CAGCCGTCAGTCGGTGAGGTGAATGGCGATCGCGGCAACTTTATGTACAGCCAGTGGAATGGCGGTGAAGGCCAGTACGGTCAATGCGCCATGAAGGTCGATTT CAAAGAAAAAGCTGCCGAACCACCAGCGCGTGCACGCGGTGCCATTGCGCGCACCTACTTCTATATGCGCGACCAATACAACCTGACACTCTCTCGCCAGCAAA CGCAGCTGTTCAACGCATGGAACAAGATGTATCCGGTTACCGACTGGGAGTGCGAGCGCGATGAACGCATCGCGAAGGTGCAGGGCAATCATAACCCGTATGTG CAACGCGCTTGCCAGGCGCGAAAGAGCTAACCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC
- Construct primers that have internal overlap with the resistance marker (pKD3) and external overlap with the target knockout gene (endA).
- Forward primer: A
- CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTC
- Reverse primer: B
- GGTTGTACGCGTGGGGTAGGGGTTAACAAAAAGAATCCCGCTAGTGTAGGATGGGAATTAGCCATGGTCC
- Forward primer: A
- Construct primers that only flank the target gene (endA) for PCR verification
- Forward primer: C
- CCAAAACAGCTTTCGCTACGTTGCT (25 bases)
- Reverse primer: D
- GGTTGTACGCGTGGGGTAGGGGTTA (25 bases)
- Forward primer: C
- Figure out the sequence and size of what you should expect if everything works. In this case, it's CmR inserted into endA flanking region (1132 bases total)
CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTGGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTC GGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGCATGGAAGCCATCACAAA CGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGC CACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAAC ACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAA CAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGG ATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAA ATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAA TACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTAT CAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGG AACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCATCCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC
References
λ red Links
endA Links
- Datsenko KA and Wanner BL. . pmid:10829079.
Contact
- Shawn Douglas — posted original protocol, performed once in August 2006.


