Pig-tailing to reduce stutter

From OpenWetWare
Revision as of 07:53, 14 April 2011 by Lowry (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

Return to Texas Switchgrass Collaborative

Pig-tailing is a technique of adding a few extra nucleotides to the 5' end of a reverse primer in order to prevent stuttering of microsatellite and other length polymorphism markers.

There are two options for Pig tailing that I know of, but I am not sure why to use one over the other:

PigA: GTTTCTT

PigB: GTTT


Make sure to attach them onto the 5' end of whichever primer you are "tailing." Make sure this is not the primer with a fluorescent or M13 label on it.

Here is an example of a reverse primer with PigA attached to it:

GTTTCTTGATCGCGCTCCTCTAATGTC

Retrieved from "https://openwetware.org/mediawiki/index.php?title=Pig-tailing_to_reduce_stutter&oldid=504191"