PCP03

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search

Current revision

comments: pTG3602 cut with PacI and NdeI then transfected into 293s with a rescue fragment from LMD's oligo experiment in fiber which resulted in production of Ad5 virus with NdeI removed in fiber. Viral DNA was then cut and ligat

sequence:

CATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAG GGGGTGGAGTTTGTGACGTGGCGCGGGGCGTGGGAACGGGGCGGGTGACG TAGTAGTGTGGCGGAAGTGTGATGTTGCAAGTGTGGCGGAACACATGTAA GCGACGGATGTGGCAAAAGTGACGTTTTTGGTGTGCGCCGGTGTACACAG GAAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAGTAAATTTGGG CGTAACCGAGTAAGATTTGGCCATTTTCGCGGGAAAACTGAATAAGAGGA AGTGAAATCTGAATAATTTTGTGTTACTCATAGCGCGTAATATTTGTCTA GGGCCGCGGGGACTTTGACCGTTTACGTGGAGACTCGCCCAGGTGTTTTT CTCAGGTGTTTTCCGCGTTCCGGGTCAAAGTTGGCGTTTTATTATTATAG TCAGCTGACGTGTAGTGTATTTATACCCGGTGAGTTCCTCAAGAGGCCAC TCTTGAGTGCCAGCGAGTAGAGTTTTCTCCTCCGAGCCGCTCCGACACCG GGACTGAAAATGAGACATATTATCTGCCACGGAGGTGTTATTACCGAAGA AATGGCCGCCAGTCTTTTGGACCAGCTGATCGAAGAGGTACTGGCTGATA ATCTTCCACCTCCTAGCCATTTTGAACCACCTACCCTTCACGAACTGTAT GATTTAGACGTGACGGCCCCCGAAGATCCCAACGAGGAGGCGGTTTCGCA GATTTTTCCCGACTCTGTAATGTTGGCGGTGCAGGAAGGGATTGACTTAC TCACTTTTCCGCCGGCGCCCGGTTCTCCGGAGCCGCCTCACCTTTCCCGG CAGCCCGAGCAGCCGGAGCAGAGAGCCTTGGGTCCGGTTTCTATGCCAAA CCTTGTACCGGAGGTGATCGATCTTACCTGCCACGAGGCTGGCTTTCCAC CCAGTGACGACGAGGATGAAGAGGGTGAGGAGTTTGTGTTAGATTATGTG GAGCACCCCGGGCACGGTTGCAGGTCTTGTCATTATCACCGGAGGAATAC GGGGGACCCAGATATTATGTGTTCGCTTTGCTATATGAGGACCTGTGGCA TGTTTGTCTACAGTAAGTGAAAATTATGGGCAGTGGGTGATAGAGTGGTG GGTTTGGTGTGGTAATTTTTTTTTTAATTTTTACAGTTTTGTGGTTTAAA GAATTTTGTATTGTGATTTTTTTAAAAGGTCCTGTGTCTGAACCTGAGCC TGAGCCCGAGCCAGAACCGGAGCCTGCAAGACCTACCCGCCGTCCTAAAA TGGCGCCTGCTATCCTGAGACGCCCGACATCACCTGTGTCTAGAGAATGC AATAGTAGTACGGATAGCTGTGACTCCGGTCCTTCTAACACACCTCCTGA GATACACCCGGTGGTCCCGCTGTGCCCCATTAAACCAGTTGCCGTGAGAG TTGGTGGGCGTCGCCAGGCTGTGGAATGTATCGAGGACTTGCTTAACGAG CCTGGGCAACCTTTGGACTTGAGCTGTAAACGCCCCAGGCCATAAGGTGT AAACCTGTGATTGCGTGTGTGGTTAACGCCTTTGTTTGCTGAATGAGTTG ATGTAAGTTTAATAAAGGGTGAGATAATGTTTAACTTGCATGGCGTGTTA AATGGGGCGGGGCTTAAAGGGTATATAATGCGCCGTGGGCTAATCTTGGT TACATCTGACCTCATGGAGGCTTGGGAGTGTTTGGAAGATTTTTCTGCTG TGCGTAACTTGCTGGAACAGAGCTCTAACAGTACCTCTTGGTTTTGGAGG TTTCTGTGGGGCTCATCCCAGGCAAAGTTAGTCTGCAGAATTAAGGAGGA TTACAAGTGGGAATTTGAAGAGCTTTTGAAATCCTGTGGTGAGCTGTTTG ATTCTTTGAATCTGGGTCACCAGGCGCTTTTCCAAGAGAAGGTCATCAAG ACTTTGGATTTTTCCACACCGGGGCGCGCTGCGGCTGCTGTTGCTTTTTT GAGTTTTATAAAGGATAAATGGAGCGAAGAAACCCATCTGAGCGGGGGGT ACCTGCTGGATTTTCTGGCCATGCATCTGTGGAGAGCGGTTGTGAGACAC AAGAATCGCCTGCTACTGTTGTCTTCCGTCCGCCCGGCGATAATACCGAC GGAGGAGCAGCAGCAGCAGCAGGAGGAAGCCAGGCGGCGGCGGCAGGAGC AGAGCCCATGGAACCCGAGAGCCGGCCTGGACCCTCGGGAATGAATGTTG TACAGGTGGCTGAACTGTATCCAGAACTGAGACGCATTTTGACAATTACA GAGGATGGGCAGGGGCTAAAGGGGGTAAAGAGGGAGCGGGGGGCTTGTGA GGCTACAGAGGAGGCTAGGAATCTAGCTTTTAGCTTAATGACCAGACACC GTCCTGAGTGTATTACTTTTCAACAGATCAAGGATAATTGCGCTAATGAG CTTGATCTGCTGGCGCAGAAGTATTCCATAGAGCAGCTGACCACTTACTG GCTGCAGCCAGGGGATGATTTTGAGGAGGCTATTAGGGTATATGCAAAGG TGGCACTTAGGCCAGATTGCAAGTACAAGATCAGCAAACTTGTAAATATC AGGAATTGTTGCTACATTTCTGGGAACGGGGCCGAGGTGGAGATAGATAC GGAGGATAGGGTGGCCTTTAGATGTAGCATGATAAATATGTGGCCGGGGG TGCTTGGCATGGACGGGGTGGTTATTATGAATGTAAGGTTTACTGGCCCC AATTTTAGCGGTACGGTTTTCCTGGCCAATACCAACCTTATCCTACACGG TGTAAGCTTCTATGGGTTTAACAATACCTGTGTGGAAGCCTGGACCGATG TAAGGGTTCGGGGCTGTGCCTTTTACTGCTGCTGGAAGGGGGTGGTGTGT CGCCCCAAAAGCAGGGCTTCAATTAAGAAATGCCTCTTTGAAAGGTGTAC CTTGGGTATCCTGTCTGAGGGTAACTCCAGGGTGCGCCACAATGTGGCCT CCGACTGTGGTTGCTTCATGCTAGTGAAAAGCGTGGCTGTGATTAAGCAT AACATGGTATGTGGCAACTGCGAGGACAGGGCCTCTCAGATGCTGACCTG CTCGGACGGCAACTGTCACCTGCTGAAGACCATTCACGTAGCCAGCCACT CTCGCAAGGCCTGGCCAGTGTTTGAGCATAACATACTGACCCGCTGTTCC TTGCATTTGGGTAACAGGAGGGGGGTGTTCCTACCTTACCAATGCAATTT GAGTCACACTAAGATATTGCTTGAGCCCGAGAGCATGTCCAAGGTGAACC TGAACGGGGTGTTTGACATGACCATGAAGATCTGGAAGGTGCTGAGGTAC GATGAGACCCGCACCAGGTGCAGACCCTGCGAGTGTGGCGGTAAACATAT TAGGAACCAGCCTGTGATGCTGGATGTGACCGAGGAGCTGAGGCCCGATC ACTTGGTGCTGGCCTGCACCCGCGCTGAGTTTGGCTCTAGCGATGAAGAT ACAGATTGAGGTACTGAAATGTGTGGGCGTGGCTTAAGGGTGGGAAAGAA TATATAAGGTGGGGGTCTTATGTAGTTTTGTATCTGTTTTGCAGCAGCCG CCGCCGCCATGAGCACCAACTCGTTTGATGGAAGCATTGTGAGCTCATAT TTGACAACGCGCATGCCCCCATGGGCCGGGGTGCGTCAGAATGTGATGGG CTCCAGCATTGATGGTCGCCCCGTCCTGCCCGCAAACTCTACTACCTTGA CCTACGAGACCGTGTCTGGAACGCCGTTGGAGACTGCAGCCTCCGCCGCC GCTTCAGCCGCTGCAGCCACCGCCCGCGGGATTGTGACTGACTTTGCTTT CCTGAGCCCGCTTGCAAGCAGTGCAGCTTCCCGTTCATCCGCCCGCGATG ACAAGTTGACGGCTCTTTTGGCACAATTGGATTCTTTGACCCGGGAACTT AATGTCGTTTCTCAGCAGCTGTTGGATCTGCGCCAGCAGGTTTCTGCCCT GAAGGCTTCCTCCCCTCCCAATGCGGTTTAAAACATAAATAAAAAACCAG ACTCTGTTTGGATTTGGATCAAGCAAGTGTCTTGCTGTCTTTATTTAGGG GTTTTGCGCGCGCGGTAGGCCCGGGACCAGCGGTCTCGGTCGTTGAGGGT CCTGTGTATTTTTTCCAGGACGTGGTAAAGGTGACTCTGGATGTTCAGAT ACATGGGCATAAGCCCGTCTCTGGGGTGGAGGTAGCACCACTGCAGAGCT TCATGCTGCGGGGTGGTGTTGTAGATGATCCAGTCGTAGCAGGAGCGCTG GGCGTGGTGCCTAAAAATGTCTTTCAGTAGCAAGCTGATTGCCAGGGGCA GGCCCTTGGTGTAAGTGTTTACAAAGCGGTTAAGCTGGGATGGGTGCATA CGTGGGGATATGAGATGCATCTTGGACTGTATTTTTAGGTTGGCTATGTT CCCAGCCATATCCCTCCGGGGATTCATGTTGTGCAGAACCACCAGCACAG TGTATCCGGTGCACTTGGGAAATTTGTCATGTAGCTTAGAAGGAAATGCG TGGAAGAACTTGGAGACGCCCTTGTGACCTCCAAGATTTTCCATGCATTC GTCCATAATGATGGCAATGGGCCCACGGGCGGCGGCCTGGGCGAAGATAT TTCTGGGATCACTAACGTCATAGTTGTGTTCCAGGATGAGATCGTCATAG GCCATTTTTACAAAGCGCGGGCGGAGGGTGCCAGACTGCGGTATAATGGT TCCATCCGGCCCAGGGGCGTAGTTACCCTCACAGATTTGCATTTCCCACG CTTTGAGTTCAGATGGGGGGATCATGTCTACCTGCGGGGCGATGAAGAAA ACGGTTTCCGGGGTAGGGGAGATCAGCTGGGAAGAAAGCAGGTTCCTGAG CAGCTGCGACTTACCGCAGCCGGTGGGCCCGTAAATCACACCTATTACCG GCTGCAACTGGTAGTTAAGAGAGCTGCAGCTGCCGTCATCCCTGAGCAGG GGGGCCACTTCGTTAAGCATGTCCCTGACTCGCATGTTTTCCCTGACCAA ATCCGCCAGAAGGCGCTCGCCGCCCAGCGATAGCAGTTCTTGCAAGGAAG CAAAGTTTTTCAACGGTTTGAGACCGTCCGCCGTAGGCATGCTTTTGAGC GTTTGACCAAGCAGTTCCAGGCGGTCCCACAGCTCGGTCACCTGCTCTAC GGCATCTCGATCCAGCATATCTCCTCGTTTCGCGGGTTGGGGCGGCTTTC GCTGTACGGCAGTAGTCGGTGCTCGTCCAGACGGGCCAGGGTCATGTCTT TCCACGGGCGCAGGGTCCTCGTCAGCGTAGTCTGGGTCACGGTGAAGGGG TGCGCTCCGGGCTGCGCGCTGGCCAGGGTGCGCTTGAGGCTGGTCCTGCT GGTGCTGAAGCGCTGCCGGTCTTCGCCCTGCGCGTCGGCCAGGTAGCATT TGACCATGGTGTCATAGTCCAGCCCCTCCGCGGCGTGGCCCTTGGCGCGC AGCTTGCCCTTGGAGGAGGCGCCGCACGAGGGGCAGTGCAGACTTTTGAG GGCGTAGAGCTTGGGCGCGAGAAATACCGATTCCGGGGAGTAGGCATCCG CGCCGCAGGCCCCGCAGACGGTCTCGCATTCCACGAGCCAGGTGAGCTCT GGCCGTTCGGGGTCAAAAACCAGGTTTCCCCCATGCTTTTTGATGCGTTT CTTACCTCTGGTTTCCATGAGCCGGTGTCCACGCTCGGTGACGAAAAGGC TGTCCGTGTCCCCGTATACAGACTTGAGAGGCCTGTCCTCGAGCGGTGTT CCGCGGTCCTCCTCGTATAGAAACTCGGACCACTCTGAGACAAAGGCTCG CGTCCAGGCCAGCACGAAGGAGGCTAAGTGGGAGGGGTAGCGGTCGTTGT CCACTAGGGGGTCCACTCGCTCCAGGGTGTGAAGACACATGTCGCCCTCT TCGGCATCAAGGAAGGTGATTGGTTTGTAGGTGTAGGCCACGTGACCGGG TGTTCCTGAAGGGGGGCTATAAAAGGGGGTGGGGGCGCGTTCGTCCTCAC TCTCTTCCGCATCGCTGTCTGCGAGGGCCAGCTGTTGGGGTGAGTACTCC CTCTGAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAA CGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGG CCGCATCCATCTGGTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGGTG GCAAACGACCCGTAGAGGGCGTTGGACAGCAACTTGGCGATGGAGCGCAG GGTTTGGTTTTTGTCGCGATCGGCGCGCTCCTTGGCCGCGATGTTTAGCT GCACGTATTCGCGCGCAACGCACCGCCATTCGGGAAAGACGGTGGTGCGC TCGTCGGGCACCAGGTGCACGCGCCAACCGCGGTTGTGCAGGGTGACAAG GTCAACGCTGGTGGCTACCTCTCCGCGTAGGCGCTCGTTGGTCCAGCAGA GGCGGCCGCCCTTGCGCGAGCAGAATGGCGGTAGGGGGTCTAGCTGCGTC TCGTCCGGGGGGTCTGCGTCCACGGTAAAGACCCCGGGCAGCAGGCGCGC GTCGAAGTAGTCTATCTTGCATCCTTGCAAGTCTAGCGCCTGCTGCCATG CGCGGGCGGCAAGCGCGCGCTCGTATGGGTTGAGTGGGGGACCCCATGGC ATGGGGTGGGTGAGCGCGGAGGCGTACATGCCGCAAATGTCGTAAACGTA GAGGGGCTCTCTGAGTATTCCAAGATATGTAGGGTAGCATCTTCCACCGC GGATGCTGGCGCGCACGTAATCGTATAGTTCGTGCGAGGGAGCGAGGAGG TCGGGACCGAGGTTGCTACGGGCGGGCTGCTCTGCTCGGAAGACTATCTG CCTGAAGATGGCATGTGAGTTGGATGATATGGTTGGACGCTGGAAGACGT TGAAGCTGGCGTCTGTGAGACCTACCGCGTCACGCACGAAGGAGGCGTAG GAGTCGCGCAGCTTGTTGACCAGCTCGGCGGTGACCTGCACGTCTAGGGC GCAGTAGTCCAGGGTTTCCTTGATGATGTCATACTTATCCTGTCCCTTTT TTTTCCACAGCTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTAC TCTTGGATCGGAAACCCGTCGGCCTCCGAACGGTAAGAGCCTAGCATGTA GAACTGGTTGACGGCCTGGTAGGCGCAGCATCCCTTTTCTACGGGTAGCG CGTATGCCTGCGCGGCCTTCCGGAGCGAGGTGTGGGTGAGCGCAAAGGTG TCCCTGACCATGACTTTGAGGTACTGGTATTTGAAGTCAGTGTCGTCGCA TCCGCCCTGCTCCCAGAGCAAAAAGTCCGTGCGCTTTTTGGAACGCGGAT TTGGCAGGGCGAAGGTGACATCGTTGAAGAGTATCTTTCCCGCGCGAGGC ATAAAGTTGCGTGTGATGCGGAAGGGTCCCGGCACCTCGGAACGGTTGTT AATTACCTGGGCGGCGAGCACGATCTCGTCAAAGCCGTTGATGTTGTGGC CCACAATGTAAAGTTCCAAGAAGCGCGGGATGCCCTTGATGGAAGGCAAT TTTTTAAGTTCCTCGTAGGTGAGCTCTTCAGGGGAGCTGAGCCCGTGCTC TGAAAGGGCCCAGTCTGCAAGATGAGGGTTGGAAGCGACGAATGAGCTCC ACAGGTCACGGGCCATTAGCATTTGCAGGTGGTCGCGAAAGGTCCTAAAC TGGCGACCTATGGCCATTTTTTCTGGGGTGATGCAGTAGAAGGTAAGCGG GTCTTGTTCCCAGCGGTCCCATCCAAGGTTCGCGGCTAGGTCTCGCGCGG CAGTCACTAGAGGCTCATCTCCGCCGAACTTCATGACCAGCATGAAGGGC ACGAGCTGCTTCCCAAAGGCCCCCATCCAAGTATAGGTCTCTACATCGTA GGTGACAAAGAGACGCTCGGTGCGAGGATGCGAGCCGATCGGGAAGAACT GGATCTCCCGCCACCAATTGGAGGAGTGGCTATTGATGTGGTGAAAGTAG AAGTCCCTGCGACGGGCCGAACACTCGTGCTGGCTTTTGTAAAAACGTGC GCAGTACTGGCAGCGGTGCACGGGCTGTACATCCTGCACGAGGTTGACCT GACGACCGCGCACAAGGAAGCAGAGTGGGAATTTGAGCCCCTCGCCTGGC GGGTTTGGCTGGTGGTCTTCTACTTCGGCTGCTTGTCCTTGACCGTCTGG CTGCTCGAGGGGAGTTACGGTGGATCGGACCACCACGCCGCGCGAGCCCA AAGTCCAGATGTCCGCGCGCGGCGGTCGGAGCTTGATGACAACATCGCGC AGATGGGAGCTGTCCATGGTCTGGAGCTCCCGCGGCGTCAGGTCAGGCGG GAGCTCCTGCAGGTTTACCTCGCATAGACGGGTCAGGGCGCGGGCTAGAT CCAGGTGATACCTAATTTCCAGGGGCTGGTTGGTGGCGGCGTCGATGGCT TGCAAGAGGCCGCATCCCCGCGGCGCGACTACGGTACCGCGCGGCGGGCG GTGGGCCGCGGGGGTGTCCTTGGATGATGCATCTAAAAGCGGTGACGCGG GCGAGCCCCCGGAGGTAGGGGGGGCTCCGGACCCGCCGGGAGAGGGGGCA GGGGCACGTCGGCGCCGCGCGCGGGCAGGAGCTGGTGCTGCGCGCGTAGG TTGCTGGCGAACGCGACGACGCGGCGGTTGATCTCCTGAATCTGGCGCCT CTGCGTGAAGACGACGGGCCCGGTGAGCTTGAACCTGAAAGAGAGTTCGA CAGAATCAATTTCGGTGTCGTTGACGGCGGCCTGGCGCAAAATCTCCTGC ACGTCTCCTGAGTTGTCTTGATAGGCGATCTCGGCCATGAACTGCTCGAT CTCTTCCTCCTGGAGATCTCCGCGTCCGGCTCGCTCCACGGTGGCGGCGA GGTCGTTGGAAATGCGGGCCATGAGCTGCGAGAAGGCGTTGAGGCCTCCC TCGTTCCAGACGCGGCTGTAGACCACGCCCCCTTCGGCATCGCGGGCGCG CATGACCACCTGCGCGAGATTGAGCTCCACGTGCCGGGCGAAGACGGCGT AGTTTCGCAGGCGCTGAAAGAGGTAGTTGAGGGTGGTGGCGGTGTGTTCT GCCACGAAGAAGTACATAACCCAGCGTCGCAACGTGGATTCGTTGATATC CCCCAAGGCCTCAAGGCGCTCCATGGCCTCGTAGAAGTCCACGGCGAAGT TGAAAAACTGGGAGTTGCGCGCCGACACGGTTAACTCCTCCTCCAGAAGA CGGATGAGCTCGGCGACAGTGTCGCGCACCTCGCGCTCAAAGGCTACAGG GGCCTCTTCTTCTTCTTCAATCTCCTCTTCCATAAGGGCCTCCCCTTCTT CTTCTTCTGGCGGCGGTGGGGGAGGGGGGACACGGCGGCGACGACGGCGC ACCGGGAGGCGGTCGACAAAGCGCTCGATCATCTCCCCGCGGCGACGGCG CATGGTCTCGGTGACGGCGCGGCCGTTCTCGCGGGGGCGCAGTTGGAAGA CGCCGCCCGTCATGTCCCGGTTATGGGTTGGCGGGGGGCTGCCATGCGGC AGGGATACGGCGCTAACGATGCATCTCAACAATTGTTGTGTAGGTACTCC GCCGCCGAGGGACCTGAGCGAGTCCGCATCGACCGGATCGGAAAACCTCT CGAGAAAGGCGTCTAACCAGTCACAGTCGCAAGGTAGGCTGAGCACCGTG GCGGGCGGCAGCGGGCGGCGGTCGGGGTTGTTTCTGGCGGAGGTGCTGCT GATGATGTAATTAAAGTAGGCGGTCTTGAGACGGCGGATGGTCGACAGAA GCACCATGTCCTTGGGTCCGGCCTGCTGAATGCGCAGGCGGTCGGCCATG CCCCAGGCTTCGTTTTGACATCGGCGCAGGTCTTTGTAGTAGTCTTGCAT GAGCCTTTCTACCGGCACTTCTTCTTCTCCTTCCTCTTGTCCTGCATCTC TTGCATCTATCGCTGCGGCGGCGGCGGAGTTTGGCCGTAGGTGGCGCCCT CTTCCTCCCATGCGTGTGACCCCGAAGCCCCTCATCGGCTGAAGCAGGGC TAGGTCGGCGACAACGCGCTCGGCTAATATGGCCTGCTGCACCTGCGTGA GGGTAGACTGGAAGTCATCCATGTCCACAAAGCGGTGGTATGCGCCCGTG TTGATGGTGTAAGTGCAGTTGGCCATAACGGACCAGTTAACGGTCTGGTG ACCCGGCTGCGAGAGCTCGGTGTACCTGAGACGCGAGTAAGCCCTCGAGT CAAATACGTAGTCGTTGCAAGTCCGCACCAGGTACTGGTATCCCACCAAA AAGTGCGGCGGCGGCTGGCGGTAGAGGGGCCAGCGTAGGGTGGCCGGGGC TCCGGGGGCGAGATCTTCCAACATAAGGCGATGATATCCGTAGATGTACC TGGACATCCAGGTGATGCCGGCGGCGGTGGTGGAGGCGCGCGGAAAGTCG CGGACGCGGTTCCAGATGTTGCGCAGCGGCAAAAAGTGCTCCATGGTCGG GACGCTCTGGCCGGTCAGGCGCGCGCAATCGTTGACGCTCTAGACCGTGC AAAAGGAGAGCCTGTAAGCGGGCACTCTTCCGTGGTCTGGTGGATAAATT CGCAAGGGTATCATGGCGGACGACCGGGGTTCGAGCCCCGTATCCGGCCG TCCGCCGTGATCCATGCGGTTACCGCCCGCGTGTCGAACCCAGGTGTGCG ACGTCAGACAACGGGGGAGTGCTCCTTTTGGCTTCCTTCCAGGCGCGGCG GCTGCTGCGCTAGCTTTTTTGGCCACTGGCCGCGCGCAGCGTAAGCGGTT AGGCTGGAAAGCGAAAGCATTAAGTGGCTCGCTCCCTGTAGCCGGAGGGT TATTTTCCAAGGGTTGAGTCGCGGGACCCCCGGTTCGAGTCTCGGACCGG CCGGACTGCGGCGAACGGGGGTTTGCCTCCCCGTCATGCAAGACCCCGCT TGCAAATTCCTCCGGAAACAGGGACGAGCCCCTTTTTTGCTTTTCCCAGA TGCATCCGGTGCTGCGGCAGATGCGCCCCCCTCCTCAGCAGCGGCAAGAG CAAGAGCAGCGGCAGACATGCAGGGCACCCTCCCCTCCTCCTACCGCGTC AGGAGGGGCGACATCCGCGGTTGACGCGGCAGCAGATGGTGATTACGAAC CCCCGCGGCGCCGGGCCCGGCACTACCTGGACTTGGAGGAGGGCGAGGGC CTGGCGCGGCTAGGAGCGCCCTCTCCTGAGCGGCACCCAAGGGTGCAGCT GAAGCGTGATACGCGTGAGGCGTACGTGCCGCGGCAGAACCTGTTTCGCG ACCGCGAGGGAGAGGAGCCCGAGGAGATGCGGGATCGAAAGTTCCACGCA GGGCGCGAGCTGCGGCATGGCCTGAATCGCGAGCGGTTGCTGCGCGAGGA GGACTTTGAGCCCGACGCGCGAACCGGGATTAGTCCCGCGCGCGCACACG TGGCGGCCGCCGACCTGGTAACCGCATACGAGCAGACGGTGAACCAGGAG ATTAACTTTCAAAAAAGCTTTAACAACCACGTGCGTACGCTTGTGGCGCG CGAGGAGGTGGCTATAGGACTGATGCATCTGTGGGACTTTGTAAGCGCGC TGGAGCAAAACCCAAATAGCAAGCCGCTCATGGCGCAGCTGTTCCTTATA GTGCAGCACAGCAGGGACAACGAGGCATTCAGGGATGCGCTGCTAAACAT AGTAGAGCCCGAGGGCCGCTGGCTGCTCGATTTGATAAACATCCTGCAGA GCATAGTGGTGCAGGAGCGCAGCTTGAGCCTGGCTGACAAGGTGGCCGCC ATCAACTATTCCATGCTTAGCCTGGGCAAGTTTTACGCCCGCAAGATATA CCATACCCCTTACGTTCCCATAGACAAGGAGGTAAAGATCGAGGGGTTCT ACATGCGCATGGCGCTGAAGGTGCTTACCTTGAGCGACGACCTGGGCGTT TATCGCAACGAGCGCATCCACAAGGCCGTGAGCGTGAGCCGGCGGCGCGA GCTCAGCGACCGCGAGCTGATGCACAGCCTGCAAAGGGCCCTGGCTGGCA CGGGCAGCGGCGATAGAGAGGCCGAGTCCTACTTTGACGCGGGCGCTGAC CTGCGCTGGGCCCCAAGCCGACGCGCCCTGGAGGCAGCTGGGGCCGGACC TGGGCTGGCGGTGGCACCCGCGCGCGCTGGCAACGTCGGCGGCGTGGAGG AATATGACGAGGACGATGAGTACGAGCCAGAGGACGGCGAGTACTAAGCG GTGATGTTTCTGATCAGATGATGCAAGACGCAACGGACCCGGCGGTGCGG GCGGCGCTGCAGAGCCAGCCGTCCGGCCTTAACTCCACGGACGACTGGCG CCAGGTCATGGACCGCATCATGTCGCTGACTGCGCGCAATCCTGACGCGT TCCGGCAGCAGCCGCAGGCCAACCGGCTCTCCGCAATTCTGGAAGCGGTG GTCCCGGCGCGCGCAAACCCCACGCACGAGAAGGTGCTGGCGATCGTAAA CGCGCTGGCCGAAAACAGGGCCATCCGGCCCGACGAGGCCGGCCTGGTCT ACGACGCGCTGCTTCAGCGCGTGGCTCGTTACAACAGCGGCAACGTGCAG ACCAACCTGGACCGGCTGGTGGGGGATGTGCGCGAGGCCGTGGCGCAGCG TGAGCGCGCGCAGCAGCAGGGCAACCTGGGCTCCATGGTTGCACTAAACG CCTTCCTGAGTACACAGCCCGCCAACGTGCCGCGGGGACAGGAGGACTAC ACCAACTTTGTGAGCGCACTGCGGCTAATGGTGACTGAGACACCGCAAAG TGAGGTGTACCAGTCTGGGCCAGACTATTTTTTCCAGACCAGTAGACAAG GCCTGCAGACCGTAAACCTGAGCCAGGCTTTCAAAAACTTGCAGGGGCTG TGGGGGGTGCGGGCTCCCACAGGCGACCGCGCGACCGTGTCTAGCTTGCT GACGCCCAACTCGCGCCTGTTGCTGCTGCTAATAGCGCCCTTCACGGACA GTGGCAGCGTGTCCCGGGACACATACCTAGGTCACTTGCTGACACTGTAC CGCGAGGCCATAGGTCAGGCGCATGTGGACGAGCATACTTTCCAGGAGAT TACAAGTGTCAGCCGCGCGCTGGGGCAGGAGGACACGGGCAGCCTGGAGG CAACCCTAAACTACCTGCTGACCAACCGGCGGCAGAAGATCCCCTCGTTG CACAGTTTAAACAGCGAGGAGGAGCGCATTTTGCGCTACGTGCAGCAGAG CGTGAGCCTTAACCTGATGCGCGACGGGGTAACGCCCAGCGTGGCGCTGG ACATGACCGCGCGCAACATGGAACCGGGCATGTATGCCTCAAACCGGCCG TTTATCAACCGCCTAATGGACTACTTGCATCGCGCGGCCGCCGTGAACCC CGAGTATTTCACCAATGCCATCTTGAACCCGCACTGGCTACCGCCCCCTG GTTTCTACACCGGGGGATTCGAGGTGCCCGAGGGTAACGATGGATTCCTC TGGGACGACATAGACGACAGCGTGTTTTCCCCGCAACCGCAGACCCTGCT AGAGTTGCAACAGCGCGAGCAGGCAGAGGCGGCGCTGCGAAAGGAAAGCT TCCGCAGGCCAAGCAGCTTGTCCGATCTAGGCGCTGCGGCCCCGCGGTCA GATGCTAGTAGCCCATTTCCAAGCTTGATAGGGTCTCTTACCAGCACTCG CACCACCCGCCCGCGCCTGCTGGGCGAGGAGGAGTACCTAAACAACTCGC TGCTGCAGCCGCAGCGCGAAAAAAACCTGCCTCCGGCATTTCCCAACAAC GGGATAGAGAGCCTAGTGGACAAGATGAGTAGATGGAAGACGTACGCGCA GGAGCACAGGGACGTGCCAGGCCCGCGCCCGCCCACCCGTCGTCAAAGGC ACGACCGTCAGCGGGGTCTGGTGTGGGAGGACGATGACTCGGCAGACGAC AGCAGCGTCCTGGATTTGGGAGGGAGTGGCAACCCGTTTGCGCACCTTCG CCCCAGGCTGGGGAGAATGTTTTAAAAAAAAAAAAAGCATGATGCAAAAT AAAAAACTCACCAAGGCCATGGCACCGAGCGTTGGTTTTCTTGTATTCCC CTTAGTATGCGGCGCGCGGCGATGTATGAGGAAGGTCCTCCTCCCTCCTA CGAGAGTGTGGTGAGCGCGGCGCCAGTGGCGGCGGCGCTGGGTTCTCCCT TCGATGCTCCCCTGGACCCGCCGTTTGTGCCTCCGCGGTACCTGCGGCCT ACCGGGGGGAGAAACAGCATCCGTTACTCTGAGTTGGCACCCCTATTCGA CACCACCCGTGTGTACCTGGTGGACAACAAGTCAACGGATGTGGCATCCC TGAACTACCAGAACGACCACAGCAACTTTCTGACCACGGTCATTCAAAAC AATGACTACAGCCCGGGGGAGGCAAGCACACAGACCATCAATCTTGACGA CCGGTCGCACTGGGGCGGCGACCTGAAAACCATCCTGCATACCAACATGC CAAATGTGAACGAGTTCATGTTTACCAATAAGTTTAAGGCGCGGGTGATG GTGTCGCGCTTGCCTACTAAGGACAATCAGGTGGAGCTGAAATACGAGTG GGTGGAGTTCACGCTGCCCGAGGGCAACTACTCCGAGACCATGACCATAG ACCTTATGAACAACGCGATCGTGGAGCACTACTTGAAAGTGGGCAGACAG AACGGGGTTCTGGAAAGCGACATCGGGGTAAAGTTTGACACCCGCAACTT CAGACTGGGGTTTGACCCCGTCACTGGTCTTGTCATGCCTGGGGTATATA CAAACGAAGCCTTCCATCCAGACATCATTTTGCTGCCAGGATGCGGGGTG GACTTCACCCACAGCCGCCTGAGCAACTTGTTGGGCATCCGCAAGCGGCA ACCCTTCCAGGAGGGCTTTAGGATCACCTACGATGATCTGGAGGGTGGTA ACATTCCCGCACTGTTGGATGTGGACGCCTACCAGGCGAGCTTGAAAGAT GACACCGAACAGGGCGGGGGTGGCGCAGGCGGCAGCAACAGCAGTGGCAG CGGCGCGGAAGAGAACTCCAACGCGGCAGCCGCGGCAATGCAGCCGGTGG AGGACATGAACGATCATGCCATTCGCGGCGACACCTTTGCCACACGGGCT GAGGAGAAGCGCGCTGAGGCCGAAGCAGCGGCCGAAGCTGCCGCCCCCGC TGCGCAACCCGAGGTCGAGAAGCCTCAGAAGAAACCGGTGATCAAACCCC TGACAGAGGACAGCAAGAAACGCAGTTACAACCTAATAAGCAATGACAGC ACCTTCACCCAGTACCGCAGCTGGTACCTTGCATACAACTACGGCGACCC TCAGACCGGAATCCGCTCATGGACCCTGCTTTGCACTCCTGACGTAACCT GCGGCTCGGAGCAGGTCTACTGGTCGTTGCCAGACATGATGCAAGACCCC GTGACCTTCCGCTCCACGCGCCAGATCAGCAACTTTCCGGTGGTGGGCGC CGAGCTGTTGCCCGTGCACTCCAAGAGCTTCTACAACGACCAGGCCGTCT ACTCCCAACTCATCCGCCAGTTTACCTCTCTGACCCACGTGTTCAATCGC TTTCCCGAGAACCAGATTTTGGCGCGCCCGCCAGCCCCCACCATCACCAC CGTCAGTGAAAACGTTCCTGCTCTCACAGATCACGGGACGCTACCGCTGC GCAACAGCATCGGAGGAGTCCAGCGAGTGACCATTACTGACGCCAGACGC CGCACCTGCCCCTACGTTTACAAGGCCCTGGGCATAGTCTCGCCGCGCGT CCTATCGAGCCGCACTTTTTGAGCAAGCATGTCCATCCTTATATCGCCCA GCAATAACACAGGCTGGGGCCTGCGCTTCCCAAGCAAGATGTTTGGCGGG GCCAAGAAGCGCTCCGACCAACACCCAGTGCGCGTGCGCGGGCACTACCG CGCGCCCTGGGGCGCGCACAAACGCGGCCGCACTGGGCGCACCACCGTCG ATGACGCCATCGACGCGGTGGTGGAGGAGGCGCGCAACTACACGCCCACG CCGCCACCAGTGTCCACAGTGGACGCGGCCATTCAGACCGTGGTGCGCGG AGCCCGGCGCTATGCTAAAATGAAGAGACGGCGGAGGCGCGTAGCACGTC GCCACCGCCGCCGACCCGGCACTGCCGCCCAACGCGCGGCGGCGGCCCTG CTTAACCGCGCACGTCGCACCGGCCGACGGGCGGCCATGCGGGCCGCTCG AAGGCTGGCCGCGGGTATTGTCACTGTGCCCCCCAGGTCCAGGCGACGAG CGGCCGCCGCAGCAGCCGCGGCCATTAGTGCTATGACTCAGGGTCGCAGG GGCAACGTGTATTGGGTGCGCGACTCGGTTAGCGGCCTGCGCGTGCCCGT GCGCACCCGCCCCCCGCGCAACTAGATTGCAAGAAAAAACTACTTAGACT CGTACTGTTGTATGTATCCAGCGGCGGCGGCGCGCAACGAAGCTATGTCC AAGCGCAAAATCAAAGAAGAGATGCTCCAGGTCATCGCGCCGGAGATCTA TGGCCCCCCGAAGAAGGAAGAGCAGGATTACAAGCCCCGAAAGCTAAAGC GGGTCAAAAAGAAAAAGAAAGATGATGATGATGAACTTGACGACGAGGTG GAACTGCTGCACGCTACCGCGCCCAGGCGACGGGTACAGTGGAAAGGTCG ACGCGTAAAACGTGTTTTGCGACCCGGCACCACCGTAGTCTTTACGCCCG GTGAGCGCTCCACCCGCACCTACAAGCGCGTGTATGATGAGGTGTACGGC GACGAGGACCTGCTTGAGCAGGCCAACGAGCGCCTCGGGGAGTTTGCCTA CGGAAAGCGGCATAAGGACATGCTGGCGTTGCCGCTGGACGAGGGCAACC CAACACCTAGCCTAAAGCCCGTAACACTGCAGCAGGTGCTGCCCGCGCTT GCACCGTCCGAAGAAAAGCGCGGCCTAAAGCGCGAGTCTGGTGACTTGGC ACCCACCGTGCAGCTGATGGTACCCAAGCGCCAGCGACTGGAAGATGTCT TGGAAAAAATGACCGTGGAACCTGGGCTGGAGCCCGAGGTCCGCGTGCGG CCAATCAAGCAGGTGGCGCCGGGACTGGGCGTGCAGACCGTGGACGTTCA GATACCCACTACCAGTAGCACCAGTATTGCCACCGCCACAGAGGGCATGG AGACACAAACGTCCCCGGTTGCCTCAGCGGTGGCGGATGCCGCGGTGCAG GCGGTCGCTGCGGCCGCGTCCAAGACCTCTACGGAGGTGCAAACGGACCC GTGGATGTTTCGCGTTTCAGCCCCCCGGCGCCCGCGCCGTTCGAGGAAGT ACGGCGCCGCCAGCGCGCTACTGCCCGAATATGCCCTACATCCTTCCATT GCGCCTACCCCCGGCTATCGTGGCTACACCTACCGCCCCAGAAGACGAGC AACTACCCGACGCCGAACCACCACTGGAACCCGCCGCCGCCGTCGCCGTC GCCAGCCCGTGCTGGCCCCGATTTCCGTGCGCAGGGTGGCTCGCGAAGGA GGCAGGACCCTGGTGCTGCCAACAGCGCGCTACCACCCCAGCATCGTTTA AAAGCCGGTCTTTGTGGTTCTTGCAGATATGGCCCTCACCTGCCGCCTCC GTTTCCCGGTGCCGGGATTCCGAGGAAGAATGCACCGTAGGAGGGGCATG GCCGGCCACGGCCTGACGGGCGGCATGCGTCGTGCGCACCACCGGCGGCG GCGCGCGTCGCACCGTCGCATGCGCGGCGGTATCCTGCCCCTCCTTATTC CACTGATCGCCGCGGCGATTGGCGCCGTGCCCGGAATTGCATCCGTGGCC TTGCAGGCGCAGAGACACTGATTAAAAACAAGTTGCATGTGGAAAAATCA AAATAAAAAGTCTGGACTCTCACGCTCGCTTGGTCCTGTAACTATTTTGT AGAATGGAAGACATCAACTTTGCGTCTCTGGCCCCGCGACACGGCTCGCG CCCGTTCATGGGAAACTGGCAAGATATCGGCACCAGCAATATGAGCGGTG GCGCCTTCAGCTGGGGCTCGCTGTGGAGCGGCATTAAAAATTTCGGTTCC ACCGTTAAGAACTATGGCAGCAAGGCCTGGAACAGCAGCACAGGCCAGAT GCTGAGGGATAAGTTGAAAGAGCAAAATTTCCAACAAAAGGTGGTAGATG GCCTGGCCTCTGGCATTAGCGGGGTGGTGGACCTGGCCAACCAGGCAGTG CAAAATAAGATTAACAGTAAGCTTGATCCCCGCCCTCCCGTAGAGGAGCC TCCACCGGCCGTGGAGACAGTGTCTCCAGAGGGGCGTGGCGAAAAGCGTC CGCGCCCCGACAGGGAAGAAACTCTGGTGACGCAAATAGACGAGCCTCCC TCGTACGAGGAGGCACTAAAGCAAGGCCTGCCCACCACCCGTCCCATCGC GCCCATGGCTACCGGAGTGCTGGGCCAGCACACACCCGTAACGCTGGACC TGCCTCCCCCCGCCGACACCCAGCAGAAACCTGTGCTGCCAGGCCCGACC GCCGTTGTTGTAACCCGTCCTAGCCGCGCGTCCCTGCGCCGCGCCGCCAG CGGTCCGCGATCGTTGCGGCCCGTAGCCAGTGGCAACTGGCAAAGCACAC TGAACAGCATCGTGGGTCTGGGGGTGCAATCCCTGAAGCGCCGACGATGC TTCTGATAGCTAACGTGTCGTATGTGTGTCATGTATGCGTCCATGTCGCC GCCAGAGGAGCTGCTGAGCCGCCGCGCGCCCGCTTTCCAAGATGGCTACC CCTTCGATGATGCCGCAGTGGTCTTACATGCACATCTCGGGCCAGGACGC CTCGGAGTACCTGAGCCCCGGGCTGGTGCAGTTTGCCCGCGCCACCGAGA CGTACTTCAGCCTGAATAACAAGTTTAGAAACCCCACGGTGGCGCCTACG CACGACGTGACCACAGACCGGTCCCAGCGTTTGACGCTGCGGTTCATCCC TGTGGACCGTGAGGATACTGCGTACTCGTACAAGGCGCGGTTCACCCTAG CTGTGGGTGATAACCGTGTGCTGGACATGGCTTCCACGTACTTTGACATC CGCGGCGTGCTGGACAGGGGCCCTACTTTTAAGCCCTACTCTGGCACTGC CTACAACGCCCTGGCTCCCAAGGGTGCCCCAAATCCTTGCGAATGGGATG AAGCTGCTACTGCTCTTGAAATAAACCTAGAAGAAGAGGACGATGACAAC GAAGACGAAGTAGACGAGCAAGCTGAGCAGCAAAAAACTCACGTATTTGG GCAGGCGCCTTATTCTGGTATAAATATTACAAAGGAGGGTATTCAAATAG GTGTCGAAGGTCAAACACCTAAATATGCCGATAAAACATTTCAACCTGAA CCTCAAATAGGAGAATCTCAGTGGTACGAAACAGAAATTAATCATGCAGC TGGGAGAGTCCTAAAAAAGACTACCCCAATGAAACCATGTTACGGTTCAT ATGCAAAACCCACAAATGAAAATGGAGGGCAAGGCATTCTTGTAAAGCAA CAAAATGGAAAGCTAGAAAGTCAAGTGGAAATGCAATTTTTCTCAACTAC TGAGGCAGCCGCAGGCAATGGTGATAACTTGACTCCTAAAGTGGTATTGT ACAGTGAAGATGTAGATATAGAAACCCCAGACACTCATATTTCTTACATG CCCACTATTAAGGAAGGTAACTCACGAGAACTAATGGGCCAACAATCTAT GCCCAACAGGCCTAATTACATTGCTTTTAGGGACAATTTTATTGGTCTAA TGTATTACAACAGCACGGGTAATATGGGTGTTCTGGCGGGCCAAGCATCG CAGTTGAATGCTGTTGTAGATTTGCAAGACAGAAACACAGAGCTTTCATA CCAGCTTTTGCTTGATTCCATTGGTGATAGAACCAGGTACTTTTCTATGT GGAATCAGGCTGTTGACAGCTATGATCCAGATGTTAGAATTATTGAAAAT CATGGAACTGAAGATGAACTTCCAAATTACTGCTTTCCACTGGGAGGTGT GATTAATACAGAGACTCTTACCAAGGTAAAACCTAAAACAGGTCAGGAAA ATGGATGGGAAAAAGATGCTACAGAATTTTCAGATAAAAATGAAATAAGA GTTGGAAATAATTTTGCCATGGAAATCAATCTAAATGCCAACCTGTGGAG AAATTTCCTGTACTCCAACATAGCGCTGTATTTGCCCGACAAGCTAAAGT ACAGTCCTTCCAACGTAAAAATTTCTGATAACCCAAACACCTACGACTAC ATGAACAAGCGAGTGGTGGCTCCCGGGCTAGTGGACTGCTACATTAACCT TGGAGCACGCTGGTCCCTTGACTATATGGACAACGTCAACCCATTTAACC ACCACCGCAATGCTGGCCTGCGCTACCGCTCAATGTTGCTGGGCAATGGT CGCTATGTGCCCTTCCACATCCAGGTGCCTCAGAAGTTCTTTGCCATTAA AAACCTCCTTCTCCTGCCGGGCTCATACACCTACGAGTGGAACTTCAGGA AGGATGTTAACATGGTTCTGCAGAGCTCCCTAGGAAATGACCTAAGGGTT GACGGAGCCAGCATTAAGTTTGATAGCATTTGCCTTTACGCCACCTTCTT CCCCATGGCCCACAACACCGCCTCCACGCTTGAGGCCATGCTTAGAAACG ACACCAACGACCAGTCCTTTAACGACTATCTCTCCGCCGCCAACATGCTC TACCCTATACCCGCCAACGCTACCAACGTGCCCATATCCATCCCCTCCCG CAACTGGGCGGCTTTCCGCGGCTGGGCCTTCACGCGCCTTAAGACTAAGG AAACCCCATCACTGGGCTCGGGCTACGACCCTTATTACACCTACTCTGGC TCTATACCCTACCTAGATGGAACCTTTTACCTCAACCACACCTTTAAGAA GGTGGCCATTACCTTTGACTCTTCTGTCAGCTGGCCTGGCAATGACCGCC TGCTTACCCCCAACGAGTTTGAAATTAAGCGCTCAGTTGACGGGGAGGGT TACAACGTTGCCCAGTGTAACATGACCAAAGACTGGTTCCTGGTACAAAT GCTAGCTAACTATAACATTGGCTACCAGGGCTTCTATATCCCAGAGAGCT ACAAGGACCGCATGTACTCCTTCTTTAGAAACTTCCAGCCCATGAGCCGT CAGGTGGTGGATGATACTAAATACAAGGACTACCAACAGGTGGGCATCCT ACACCAACACAACAACTCTGGATTTGTTGGCTACCTTGCCCCCACCATGC GCGAAGGACAGGCCTACCCTGCTAACTTCCCCTATCCGCTTATAGGCAAG ACCGCAGTTGACAGCATTACCCAGAAAAAGTTTCTTTGCGATCGCACCCT TTGGCGCATCCCATTCTCCAGTAACTTTATGTCCATGGGCGCACTCACAG ACCTGGGCCAAAACCTTCTCTACGCCAACTCCGCCCACGCGCTAGACATG ACTTTTGAGGTGGATCCCATGGACGAGCCCACCCTTCTTTATGTTTTGTT TGAAGTCTTTGACGTGGTCCGTGTGCACCAGCCGCACCGCGGCGTCATCG AAACCGTGTACCTGCGCACGCCCTTCTCGGCCGGCAACGCCACAACATAA AGAAGCAAGCAACATCAACAACAGCTGCCGCCATGGGCTCCAGTGAGCAG GAACTGAAAGCCATTGTCAAAGATCTTGGTTGTGGGCCATATTTTTTGGG CACCTATGACAAGCGCTTTCCAGGCTTTGTTTCTCCACACAAGCTCGCCT GCGCCATAGTCAATACGGCCGGTCGCGAGACTGGGGGCGTACACTGGATG GCCTTTGCCTGGAACCCGCACTCAAAAACATGCTACCTCTTTGAGCCCTT TGGCTTTTCTGACCAGCGACTCAAGCAGGTTTACCAGTTTGAGTACGAGT CACTCCTGCGCCGTAGCGCCATTGCTTCTTCCCCCGACCGCTGTATAACG CTGGAAAAGTCCACCCAAAGCGTACAGGGGCCCAACTCGGCCGCCTGTGG ACTATTCTGCTGCATGTTTCTCCACGCCTTTGCCAACTGGCCCCAAACTC CCATGGATCACAACCCCACCATGAACCTTATTACCGGGGTACCCAACTCC ATGCTCAACAGTCCCCAGGTACAGCCCACCCTGCGTCGCAACCAGGAACA GCTCTACAGCTTCCTGGAGCGCCACTCGCCCTACTTCCGCAGCCACAGTG CGCAGATTAGGAGCGCCACTTCTTTTTGTCACTTGAAAAACATGTAAAAA TAATGTACTAGAGACACTTTCAATAAAGGCAAATGCTTTTATTTGTACAC TCTCGGGTGATTATTTACCCCCACCCTTGCCGTCTGCGCCGTTTAAAAAT CAAAGGGGTTCTGCCGCGCATCGCTATGCGCCACTGGCAGGGACACGTTG CGATACTGGTGTTTAGTGCTCCACTTAAACTCAGGCACAACCATCCGCGG CAGCTCGGTGAAGTTTTCACTCCACAGGCTGCGCACCATCACCAACGCGT TTAGCAGGTCGGGCGCCGATATCTTGAAGTCGCAGTTGGGGCCTCCGCCC TGCGCGCGCGAGTTGCGATACACAGGGTTGCAGCACTGGAACACTATCAG CGCCGGGTGGTGCACGCTGGCCAGCACGCTCTTGTCGGAGATCAGATCCG CGTCCAGGTCCTCCGCGTTGCTCAGGGCGAACGGAGTCAACTTTGGTAGC TGCCTTCCCAAAAAGGGCGCGTGCCCAGGCTTTGAGTTGCACTCGCACCG TAGTGGCATCAAAAGGTGACCGTGCCCGGTCTGGGCGTTAGGATACAGCG CCTGCATAAAAGCCTTGATCTGCTTAAAAGCCACCTGAGCCTTTGCGCCT TCAGAGAAGAACATGCCGCAAGACTTGCCGGAAAACTGATTGGCCGGACA GGCCGCGTCGTGCACGCAGCACCTTGCGTCGGTGTTGGAGATCTGCACCA CATTTCGGCCCCACCGGTTCTTCACGATCTTGGCCTTGCTAGACTGCTCC TTCAGCGCGCGCTGCCCGTTTTCGCTCGTCACATCCATTTCAATCACGTG CTCCTTATTTATCATAATGCTTCCGTGTAGACACTTAAGCTCGCCTTCGA TCTCAGCGCAGCGGTGCAGCCACAACGCGCAGCCCGTGGGCTCGTGATGC TTGTAGGTCACCTCTGCAAACGACTGCAGGTACGCCTGCAGGAATCGCCC CATCATCGTCACAAAGGTCTTGTTGCTGGTGAAGGTCAGCTGCAACCCGC GGTGCTCCTCGTTCAGCCAGGTCTTGCATACGGCCGCCAGAGCTTCCACT TGGTCAGGCAGTAGTTTGAAGTTCGCCTTTAGATCGTTATCCACGTGGTA CTTGTCCATCAGCGCGCGCGCAGCCTCCATGCCCTTCTCCCACGCAGACA CGATCGGCACACTCAGCGGGTTCATCACCGTAATTTCACTTTCCGCTTCG CTGGGCTCTTCCTCTTCCTCTTGCGTCCGCATACCACGCGCCACTGGGTC GTCTTCATTCAGCCGCCGCACTGTGCGCTTACCTCCTTTGCCATGCTTGA TTAGCACCGGTGGGTTGCTGAAACCCACCATTTGTAGCGCCACATCTTCT CTTTCTTCCTCGCTGTCCACGATTACCTCTGGTGATGGCGGGCGCTCGGG CTTGGGAGAAGGGCGCTTCTTTTTCTTCTTGGGCGCAATGGCCAAATCCG CCGCCGAGGTCGATGGCCGCGGGCTGGGTGTGCGCGGCACCAGCGCGTCT TGTGATGAGTCTTCCTCGTCCTCGGACTCGATACGCCGCCTCATCCGCTT TTTTGGGGGCGCCCGGGGAGGCGGCGGCGACGGGGACGGGGACGACACGT CCTCCATGGTTGGGGGACGTCGCGCCGCACCGCGTCCGCGCTCGGGGGTG GTTTCGCGCTGCTCCTCTTCCCGACTGGCCATTTCCTTCTCCTATAGGCA GAAAAAGATCATGGAGTCAGTCGAGAAGAAGGACAGCCTAACCGCCCCCT CTGAGTTCGCCACCACCGCCTCCACCGATGCCGCCAACGCGCCTACCACC TTCCCCGTCGAGGCACCCCCGCTTGAGGAGGAGGAAGTGATTATCGAGCA GGACCCAGGTTTTGTAAGCGAAGACGACGAGGACCGCTCAGTACCAACAG AGGATAAAAAGCAAGACCAGGACAACGCAGAGGCAAACGAGGAACAAGTC GGGCGGGGGGACGAAAGGCATGGCGACTACCTAGATGTGGGAGACGACGT GCTGTTGAAGCATCTGCAGCGCCAGTGCGCCATTATCTGCGACGCGTTGC AAGAGCGCAGCGATGTGCCCCTCGCCATAGCGGATGTCAGCCTTGCCTAC GAACGCCACCTATTCTCACCGCGCGTACCCCCCAAACGCCAAGAAAACGG CACATGCGAGCCCAACCCGCGCCTCAACTTCTACCCCGTATTTGCCGTGC CAGAGGTGCTTGCCACCTATCACATCTTTTTCCAAAACTGCAAGATACCC CTATCCTGCCGTGCCAACCGCAGCCGAGCGGACAAGCAGCTGGCCTTGCG GCAGGGCGCTGTCATACCTGATATCGCCTCGCTCAACGAAGTGCCAAAAA TCTTTGAGGGTCTTGGACGCGACGAGAAGCGCGCGGCAAACGCTCTGCAA CAGGAAAACAGCGAAAATGAAAGTCACTCTGGAGTGTTGGTGGAACTCGA GGGTGACAACGCGCGCCTAGCCGTACTAAAACGCAGCATCGAGGTCACCC ACTTTGCCTACCCGGCACTTAACCTACCCCCCAAGGTCATGAGCACAGTC ATGAGTGAGCTGATCGTGCGCCGTGCGCAGCCCCTGGAGAGGGATGCAAA TTTGCAAGAACAAACAGAGGAGGGCCTACCCGCAGTTGGCGACGAGCAGC TAGCGCGCTGGCTTCAAACGCGCGAGCCTGCCGACTTGGAGGAGCGACGC AAACTAATGATGGCCGCAGTGCTCGTTACCGTGGAGCTTGAGTGCATGCA GCGGTTCTTTGCTGACCCGGAGATGCAGCGCAAGCTAGAGGAAACATTGC ACTACACCTTTCGACAGGGCTACGTACGCCAGGCCTGCAAGATCTCCAAC GTGGAGCTCTGCAACCTGGTCTCCTACCTTGGAATTTTGCACGAAAACCG CCTTGGGCAAAACGTGCTTCATTCCACGCTCAAGGGCGAGGCGCGCCGCG ACTACGTCCGCGACTGCGTTTACTTATTTCTATGCTACACCTGGCAGACG GCCATGGGCGTTTGGCAGCAGTGCTTGGAGGAGTGCAACCTCAAGGAGCT GCAGAAACTGCTAAAGCAAAACTTGAAGGACCTATGGACGGCCTTCAACG AGCGCTCCGTGGCCGCGCACCTGGCGGACATCATTTTCCCCGAACGCCTG CTTAAAACCCTGCAACAGGGTCTGCCAGACTTCACCAGTCAAAGCATGTT GCAGAACTTTAGGAACTTTATCCTAGAGCGCTCAGGAATCTTGCCCGCCA CCTGCTGTGCACTTCCTAGCGACTTTGTGCCCATTAAGTACCGCGAATGC CCTCCGCCGCTTTGGGGCCACTGCTACCTTCTGCAGCTAGCCAACTACCT TGCCTACCACTCTGACATAATGGAAGACGTGAGCGGTGACGGTCTACTGG AGTGTCACTGTCGCTGCAACCTATGCACCCCGCACCGCTCCCTGGTTTGC AATTCGCAGCTGCTTAACGAAAGTCAAATTATCGGTACCTTTGAGCTGCA GGGTCCCTCGCCTGACGAAAAGTCCGCGGCTCCGGGGTTGAAACTCACTC CGGGGCTGTGGACGTCGGCTTACCTTCGCAAATTTGTACCTGAGGACTAC CACGCCCACGAGATTAGGTTCTACGAAGACCAATCCCGCCCGCCTAATGC GGAGCTTACCGCCTGCGTCATTACCCAGGGCCACATTCTTGGCCAATTGC AAGCCATCAACAAAGCCCGCCAAGAGTTTCTGCTACGAAAGGGACGGGGG GTTTACTTGGACCCCCAGTCCGGCGAGGAGCTCAACCCAATCCCCCCGCC GCCGCAGCCCTATCAGCAGCAGCCGCGGGCCCTTGCTTCCCAGGATGGCA CCCAAAAAGAAGCTGCAGCTGCCGCCGCCACCCACGGACGAGGAGGAATA CTGGGACAGTCAGGCAGAGGAGGTTTTGGACGAGGAGGAGGAGGACATGA TGGAAGACTGGGAGAGCCTAGACGAGGAAGCTTCCGAGGTCGAAGAGGTG TCAGACGAAACACCGTCACCCTCGGTCGCATTCCCCTCGCCGGCGCCCCA GAAATCGGCAACCGGTTCCAGCATGGCTACAACCTCCGCTCCTCAGGCGC CGCCGGCACTGCCCGTTCGCCGACCCAACCGTAGATGGGACACCACTGGA ACCAGGGCCGGTAAGTCCAAGCAGCCGCCGCCGTTAGCCCAAGAGCAACA ACAGCGCCAAGGCTACCGCTCATGGCGCGGGCACAAGAACGCCATAGTTG CTTGCTTGCAAGACTGTGGGGGCAACATCTCCTTCGCCCGCCGCTTTCTT CTCTACCATCACGGCGTGGCCTTCCCCCGTAACATCCTGCATTACTACCG TCATCTCTACAGCCCATACTGCACCGGCGGCAGCGGCAGCAACAGCAGCG GCCACACAGAAGCAAAGGCGACCGGATAGCAAGACTCTGACAAAGCCCAA GAAATCCACAGCGGCGGCAGCAGCAGGAGGAGGAGCGCTGCGTCTGGCGC CCAACGAACCCGTATCGACCCGCGAGCTTAGAAACAGGATTTTTCCCACT CTGTATGCTATATTTCAACAGAGCAGGGGCCAAGAACAAGAGCTGAAAAT AAAAAACAGGTCTCTGCGATCCCTCACCCGCAGCTGCCTGTATCACAAAA GCGAAGATCAGCTTCGGCGCACGCTGGAAGACGCGGAGGCTCTCTTCAGT AAATACTGCGCGCTGACTCTTAAGGACTAGTTTCGCGCCCTTTCTCAAAT TTAAGCGCGAAAACTACGTCATCTCCAGCGGCCACACCCGGCGCCAGCAC CTGTTGTCAGCGCCATTATGAGCAAGGAAATTCCCACGCCCTACATGTGG AGTTACCAGCCACAAATGGGACTTGCGGCTGGAGCTGCCCAAGACTACTC AACCCGAATAAACTACATGAGCGCGGGACCCCACATGATATCCCGGGTCA ACGGAATACGCGCCCACCGAAACCGAATTCTCCTGGAACAGGCGGCTATT ACCACCACACCTCGTAATAACCTTAATCCCCGTAGTTGGCCCGCTGCCCT GGTGTACCAGGAAAGTCCCGCTCCCACCACTGTGGTACTTCCCAGAGACG CCCAGGCCGAAGTTCAGATGACTAACTCAGGGGCGCAGCTTGCGGGCGGC TTTCGTCACAGGGTGCGGTCGCCCGGGCAGGGTATAACTCACCTGACAAT CAGAGGGCGAGGTATTCAGCTCAACGACGAGTCGGTGAGCTCCTCGCTTG GTCTCCGTCCGGACGGGACATTTCAGATCGGCGGCGCCGGCCGCTCTTCA TTCACGCCTCGTCAGGCAATCCTAACTCTGCAGACCTCGTCCTCTGAGCC GCGCTCTGGAGGCATTGGAACTCTGCAATTTATTGAGGAGTTTGTGCCAT CGGTCTACTTTAACCCCTTCTCGGGACCTCCCGGCCACTATCCGGATCAA TTTATTCCTAACTTTGACGCGGTAAAGGACTCGGCGGACGGCTACGACTG AATGTTAAGTGGAGAGGCAGAGCAACTGCGCCTGAAACACCTGGTCCACT GTCGCCGCCACAAGTGCTTTGCCCGCGACTCCGGTGAGTTTTGCTACTTT GAATTGCCCGAGGATCATATCGAGGGCCCGGCGCACGGCGTCCGGCTTAC CGCCCAGGGAGAGCTTGCCCGTAGCCTGATTCGGGAGTTTACCCAGCGCC CCCTGCTAGTTGAGCGGGACAGGGGACCCTGTGTTCTCACTGTGATTTGC AACTGTCCTAACCCTGGATTACATCAAGATCTTTGTTGCCATCTCTGTGC TGAGTATAATAAATACAGAAATTAAAATATACTGGGGCTCCTATCGCCAT CCTGTAAACGCCACCGTCTTCACCCGCCCAAGCAAACCAAGGCGAACCTT ACCTGGTACTTTTAACATCTCTCCCTCTGTGATTTACAACAGTTTCAACC CAGACGGAGTGAGTCTACGAGAGAACCTCTCCGAGCTCAGCTACTCCATC AGAAAAAACACCACCCTCCTTACCTGCCGGGAACGTACGAGTGCGTCACC GGCCGCTGCACCACACCTACCGCCTGACCGTAAACCAGACTTTTTCCGGA CAGACCTCAATAACTCTGTTTACCAGAACAGGAGGTGAGCTTAGAAAACC CTTAGGGTATTAGGCCAAAGGCGCAGCTACTGTGGGGTTTATGAACAATT CAAGCAACTCTACGGGCTATTCTAATTCAGGTTTCTCTAGAATCGGGGTT GGGGTTATTCTCTGTCTTGTGATTCTCTTTATTCTTATACTAACGCTTCT CTGCCTAAGGCTCGCCGCCTGCTGTGTGCACATTTGCATTTATTGTCAGC TTTTTAAACGCTGGGGTCGCCACCCAAGATGATTAGGTACATAATCCTAG GTTTACTCACCCTTGCGTCAGCCCACGGTACCACCCAAAAGGTGGATTTT AAGGAGCCAGCCTGTAATGTTACATTCGCAGCTGAAGCTAATGAGTGCAC CACTCTTATAAAATGCACCACAGAACATGAAAAGCTGCTTATTCGCCACA AAAACAAAATTGGCAAGTATGCTGTTTATGCTATTTGGCAGCCAGGTGAC ACTACAGAGTATAATGTTACAGTTTTCCAGGGTAAAAGTCATAAAACTTT TATGTATACTTTTCCATTTTATGAAATGTGCGACATTACCATGTACATGA GCAAACAGTATAAGTTGTGGCCCCCACAAAATTGTGTGGAAAACACTGGC ACTTTCTGCTGCACTGCTATGCTAATTACAGTGCTCGCTTTGGTCTGTAC CCTACTCTATATTAAATACAAAAGCAGACGCAGCTTTATTGAGGAAAAGA AAATGCCTTAATTTACTAAGTTACAAAGCTAATGTCACCACTAACTGCTT TACTCGCTGCTTGCAAAACAAATTCAAAAAGTTAGCATTATAATTAGAAT AGGATTTAAACCCCCCGGTCATTTCCTGCTCAATACCATTCCCCTGAACA ATTGACTCTATGTGGGATATGCTCCAGCGCTACAACCTTGAAGTCAGGCT TCCTGGATGTCAGCATCTGACTTTGGCCAGCACCTGTCCCGCGGATTTGT TCCAGTCCAACTACAGCGACCCACCCTAACAGAGATGACCAACACAACCA ACGCGGCCGCCGCTACCGGACTTACATCTACCACAAATACACCCCAAGTT TCTGCCTTTGTCAATAACTGGGATAACTTGGGCATGTGGTGGTTCTCCAT AGCGCTTATGTTTGTATGCCTTATTATTATGTGGCTCATCTGCTGCCTAA AGCGCAAACGCGCCCGACCACCCATCTATAGTCCCATCATTGTGCTACAC CCAAACAATGATGGAATCCATAGATTGGACGGACTGAAACACATGTTCTT TTCTCTTACAGTATGATTAAATGAGACATGATTCCTCGAGTTTTTATATT ACTGACCCTTGTTGCGCTTTTTTGTGCGTGCTCCACATTGGCTGCGGTTT CTCACATCGAAGTAGACTGCATTCCAGCCTTCACAGTCTATTTGCTTTAC GGATTTGTCACCCTCACGCTCATCTGCAGCCTCATCACTGTGGTCATCGC CTTTATCCAGTGCATTGACTGGGTCTGTGTGCGCTTTGCATATCTCAGAC ACCATCCCCAGTACAGGGACAGGACTATAGCTGAGCTTCTTAGAATTCTT TAATTATGAAATTTACTGTGACTTTTCTGCTGATTATTTGCACCCTATCT GCGTTTTGTTCCCCGACCTCCAAGCCTCAAAGACATATATCATGCAGATT CACTCGTATATGGAATATTCCAAGTTGCTACAATGAAAAAAGCGATCTTT CCGAAGCCTGGTTATATGCAATCATCTCTGTTATGGTGTTCTGCAGTACC ATCTTAGCCCTAGCTATATATCCCTACCTTGACATTGGCTGGAACGCAAT AGATGCCATGAACCACCCAACTTTCCCCGCGCCCGCTATGCTTCCACTGC AACAAGTTGTTGCCGGCGGCTTTGTCCCAGCCAATCAGCCTCGCCCACCT TCTCCCACCCCCACTGAAATCAGCTACTTTAATCTAACAGGAGGAGATGA CTGACACCCTAGATCTAGAAATGGACGGAATTATTACAGAGCAGCGCCTG CTAGAAAGACGCAGGGCAGCGGCCGAGCAACAGCGCATGAATCAAGAGCT CCAAGACATGGTTAACTTGCACCAGTGCAAAAGGGGTATCTTTTGTCTCG TAAAGCAGGCCAAAGTCACCTACGACAGTAATACCACCGGACACCGCCTT AGCTACAAGTTGCCAACCAAGCGTCAGAAATTGGTGGTCATGGTGGGAGA AAAGCCCATTACCATAACTCAGCACTCGGTAGAAACCGAAGGCTGCATTC ACTCACCTTGTCAAGGACCTGAGGATCTCTGCACCCTTATTAAGACCCTG TGCGGTCTCAAAGATCTTATTCCCTTTAACTAATAAAAAAAAATAATAAA GCATCACTTACTTAAAATCAGTTAGCAAATTTCTGTCCAGTTTATTCAGC AGCACCTCCTTGCCCTCCTCCCAGCTCTGGTATTGCAGCTTCCTCCTGGC TGCAAACTTTCTCCACAATCTAAATGGAATGTCAGTTTCCTCCTGTTCCT GTCCATCCGCACCCACTATCTTCATGTTGTTGCAGATGAAGCGCGCAAGA CCGTCTgaagataccttcaaccccgtgtatccgtacgacacggaaaccgg tcctccaactgtgccTTTTCTTACTCCTCCCTTTGTATCCCCCAATGGGT TTCAAGAGAGTCCCCCTGGGGTACTCTCTTTGCGCCTATCCGAACCTCTA GTTACCTCCAATGGCATGCTTGCGCTCAAAATGGGCAACGGCCTCTCTCT GGACGAGGCCGGCAACCTTACCTCCCAAAATGTAACCACTGTGAGCCCAC CTCTCAAAAAAACCAAGTCAAACATAAACCTGGAAATATCTGCACCCCTC ACAGTTACCTCAGAAGCCCTAACTGTGGCTGCCGCCGCACCTCTAATGGT CGCGGGCAACACACTCACCATGCAATCACAGGCCCCGCTAACCGTGCACG ACTCCAAACTTAGCATTGCCACCCAAGGACCCCTCACAGTGTCAGAAGGA AAGCTAGCCCTGCAAACATCAGGCCCCCTCACCACCACCGATAGCAGTAC CCTTACTATCACTGCCTCACCCCCTCTAACTACTGCCACTGGTAGCTTGG GCATTGACTTGAAAGAGCCCATTTATACACAAAATGGAAAACTAGGACTA AAGTACGGGGCTCCTTTGCATGTAACAGACGACCTAAACACTTTGACCGT AGCAACTGGTCCAGGTGTGACTATTAATAATACTTCCTTGCAAACTAAAG TTACTGGAGCCTTGGGTTTTGATTCACAAGGCAATATGCAACTTAATGTA GCAGGAGGACTAAGGATTGATTCTCAAAACAGACGCCTTATACTTGATGT TAGTTATCCGTTTGATGCTCAAAACCAACTAAATCTAAGACTAGGACAGG GCCCTCTTTTTATAAACTCAGCCCACAACTTGGATATTAACTACAACAAA GGCCTTTACTTGTTTACAGCTTCAAACAATTCCAAAAAGCTTGAGGTTAA CCTAAGCACTGCCAAGGGGTTGATGTTTGACGCTACAGCCATAGCCATTA ATGCAGGAGATGGGCTTGAATTTGGTTCACCTAATGCACCAAACACAAAT CCCCTCAAAACAAAAATTGGCCATGGCCTAGAATTTGATTCAAACAAGGC TATGGTTCCTAAACTAGGAACTGGCCTTAGTTTTGACAGCACAGGTGCCA TTACAGTAGGAAACAAAAATAATGATAAGCTAACTTTGTGGACCACACCA GCTCCATCTCCTAACTGTAGACTAAATGCAGAGAAAGATGCTAAACTCAC TTTGGTCTTAACAAAATGTGGCAGTCAAATACTTGCTACAGTTTCAGTTT TGGCTGTTAAAGGCAGTTTGGCTCCAATATCTGGAACAGTTCAAAGTGCT CATCTTATTATAAGATTTGACGAAAATGGAGTGCTACTAAACAATTCCTT CCTGGACCCAGAATATTGGAACTTTAGAAATGGAGATCTTACTGAAGGCA CAGCCTATACAAACGCTGTTGGATTTATGCCTAACCTATCAGCTTATCCA AAATCTCACGGTAAAACTGCCAAAAGTAACATTGTCAGTCAAGTTTACTT AAACGGAGACAAAACTAAACCTGTAACACTAACCATTACACTAAACGGTA CACAGGAAACAGGAGACACAACTCCAAGTGCATACTCTATGTCATTTTCA TGGGACTGGTCTGGCCACAACTACATTAATGAAATATTTGCCACATCCTC TTACACTTTTTCATACATTGCCCAAGAATAAAGAATCGTTTGTGTTATGT TTCAACGTGTTTATTTTTCAATTGCAGAAAATTTCAAGTCATTTTTCATT CAGTAGTATAGCCCCACCACCACATAGCTTATACAGATCACCGTACCTTA ATCAAACTCACAGAACCCTAGTATTCAACCTGCCACCTCCCTCCCAACAC ACAGAGTACACAGTCCTTTCTCCCCGGCTGGCCTTAAAAAGCATCATATC ATGGGTAACAGACATATTCTTAGGTGTTATATTCCACACGGTTTCCTGTC GAGCCAAACGCTCATCAGTGATATTAATAAACTCCCCGGGCAGCTCACTT AAGTTCATGTCGCTGTCCAGCTGCTGAGCCACAGGCTGCTGTCCAACTTG CGGTTGCTTAACGGGCGGCGAAGGAGAAGTCCACGCCTACATGGGGGTAG AGTCATAATCGTGCATCAGGATAGGGCGGTGGTGCTGCAGCAGCGCGCGA ATAAACTGCTGCCGCCGCCGCTCCGTCCTGCAGGAATACAACATGGCAGT GGTCTCCTCAGCGATGATTCGCACCGCCCGCAGCATAAGGCGCCTTGTCC TCCGGGCACAGCAGCGCACCCTGATCTCACTTAAATCAGCACAGTAACTG CAGCACAGCACCACAATATTGTTCAAAATCCCACAGTGCAAGGCGCTGTA TCCAAAGCTCATGGCGGGGACCACAGAACCCACGTGGCCATCATACCACA AGCGCAGGTAGATTAAGTGGCGACCCCTCATAAACACGCTGGACATAAAC ATTACCTCTTTTGGCATGTTGTAATTCACCACCTCCCGGTACCATATAAA CCTCTGATTAAACATGGCGCCATCCACCACCATCCTAAACCAGCTGGCCA AAACCTGCCCGCCGGCTATACACTGCAGGGAACCGGGACTGGAACAATGA CAGTGGAGAGCCCAGGACTCGTAACCATGGATCATCATGCTCGTCATGAT ATCAATGTTGGCACAACACAGGCACACGTGCATACACTTCCTCAGGATTA CAAGCTCCTCCCGCGTTAGAACCATATCCCAGGGAACAACCCATTCCTGA ATCAGCGTAAATCCCACACTGCAGGGAAGACCTCGCACGTAACTCACGTT GTGCATTGTCAAAGTGTTACATTCGGGCAGCAGCGGATGATCCTCCAGTA TGGTAGCGCGGGTTTCTGTCTCAAAAGGAGGTAGACGATCCCTACTGTAC GGAGTGCGCCGAGACAACCGAGATCGTGTTGGTCGTAGTGTCATGCCAAA TGGAACGCCGGACGTAGTCATATTTCCTGAAGCAAAACCAGGTGCGGGCG TGACAAACAGATCTGCGTCTCCGGTCTCGCCGCTTAGATCGCTCTGTGTA GTAGTTGTAGTATATCCACTCTCTCAAAGCATCCAGGCGCCCCCTGGCTT CGGGTTCTATGTAAACTCCTTCATGCGCCGCTGCCCTGATAACATCCACC ACCGCAGAATAAGCCACACCCAGCCAACCTACACATTCGTTCTGCGAGTC ACACACGGGAGGAGCGGGAAGAGCTGGAAGAACCATGTTTTTTTTTTTAT TCCAAAAGATTATCCAAAACCTCAAAATGAAGATCTATTAAGTGAACGCG CTCCCCTCCGGTGGCGTGGTCAAACTCTACAGCCAAAGAACAGATAATGG CATTTGTAAGATGTTGCACAATGGCTTCCAAAAGGCAAACGGCCCTCACG TCCAAGTGGACGTAAAGGCTAAACCCTTCAGGGTGAATCTCCTCTATAAA CATTCCAGCACCTTCAACCATGCCCAAATAATTCTCATCTCGCCACCTTC TCAATATATCTCTAAGCAAATCCCGAATATTAAGTCCGGCCATTGTAAAA ATCTGCTCCAGAGCGCCCTCCACCTTCAGCCTCAAGCAGCGAATCATGAT TGCAAAAATTCAGGTTCCTCACAGACCTGTATAAGATTCAAAAGCGGAAC ATTAACAAAAATACCGCGATCCCGTAGGTCCCTTCGCAGGGCCAGCTGAA CATAATCGTGCAGGTCTGCACGGACCAGCGCGGCCACTTCCCCGCCAGGA ACCATGACAAAAGAACCCACACTGATTATGACACGCATACTCGGAGCTAT GCTAACCAGCGTAGCCCCGATGTAAGCTTGTTGCATGGGCGGCGATATAA AATGCAAGGTGCTGCTCAAAAAATCAGGCAAAGCCTCGCGCAAAAAAGAA AGCACATCGTAGTCATGCTCATGCAGATAAAGGCAGGTAAGCTCCGGAAC CACCACAGAAAAAGACACCATTTTTCTCTCAAACATGTCTGCGGGTTTCT GCATAAACACAAAATAAAATAACAAAAAAACATTTAAACATTAGAAGCCT GTCTTACAACAGGAAAAACAACCCTTATAAGCATAAGACGGACTACGGCC ATGCCGGCGTGACCGTAAAAAAACTGGTCACCGTGATTAAAAAGCACCAC CGACAGCTCCTCGGTCATGTCCGGAGTCATAATGTAAGACTCGGTAAACA CATCAGGTTGATTCACATCGGTCAGTGCTAAAAAGCGACCGAAATAGCCC GGGGGAATACATACCCGCAGGCGTAGAGACAACATTACAGCCCCCATAGG AGGTATAACAAAATTAATAGGAGAGAAAAACACATAAACACCTGAAAAAC CCTCCTGCCTAGGCAAAATAGCACCCTCCCGCTCCAGAACAACATACAGC GCTTCCACAGCGGCAGCCATAACAGTCAGCCTTACCAGTAAAAAAGAAAA CCTATTAAAAAAACACCACTCGACACGGCACCAGCTCAATCAGTCACAGT GTAAAAAAGGGCCAAGTGCAGAGCGAGTATATATAGGACTAAAAAATGAC GTAACGGTTAAAGTCCACAAAAAACACCCAGAAAACCGCACGCGAACCTA CGCCCAGAAACGAAAGCCAAAAAACCCACAACTTCCTCAAATCGTCACTT CCGTTTTCCCACGTTACGTCACTTCCCATTTTAAGAAAACTACAATTCCC AACACATACAAGTTACTCCGCCCTAAAACCTACGTCACCCGCCCCGTTCC CACGCCCCGCGCCACGTCACAAACTCCACCCCCTCATTATCATATTGGCT TCAATCCAAAATAAGGTATATTATTGATGATGTTAATTAAGAATTCGGAT CTGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCC GGCGGCATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGA TGACGACCATCAGGGACAGCTTCAAGGCCAGCAAAAGGCCAGGAACCGTA AAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAG CATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACT ATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTG TTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTA GGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCG ACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGA CACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGC GAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACG GCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTT ACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGC TGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAA AAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAG TGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAG GATCTTCACCTAGATCCTTTTAAATCAATCTAAAGTATATATGAGTAAAC TTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGA TCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATA ACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACC GCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAG CCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATC CAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAA TAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCT CGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGA GTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCC TCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTA TGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTT TCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCG GCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCAC ATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGA AAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCAC TCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTG GGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCG ACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAG CATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTT AGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCA CCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAG GCGTATCACGAGGCCCTTTCGTCTTCAAGAATTGGATCCGAATTCTTAAT TAA

Personal tools