NanoBio: PCR
From OpenWetWare
(Difference between revisions)
(→D. Gel analysis and purification of PCR products) |
(→Condition B: Pfx Polymerase) |
||
| Line 71: | Line 71: | ||
=== Condition B: Pfx Polymerase === | === Condition B: Pfx Polymerase === | ||
| + | ====Materials Required==== | ||
| + | |||
| + | ====Procedure==== | ||
#Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM. | #Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM. | ||
#Use Invitrogen's Pfx polymerase (Invitrogen catalog #11708-013). | #Use Invitrogen's Pfx polymerase (Invitrogen catalog #11708-013). | ||
#Mix, adding the enzyme last: | #Mix, adding the enzyme last: | ||
#* 3 µL primer mix (10µM of each primer) | #* 3 µL primer mix (10µM of each primer) | ||
| + | #** I typically make this primer mix by adding 1 µL of the 100 µM forward primer, 1 µL of the 100 uM forward primer, and 8 µL of sterile water. | ||
#* 0.8 µL template DNA | #* 0.8 µL template DNA | ||
#* 25 µL 10X PFx amplification buffer | #* 25 µL 10X PFx amplification buffer | ||
Revision as of 20:17, 16 April 2008
Contents |
Primer design for PCR
- General Design considerations. Make sure that:
- The primer length is between 15-30 bp. I suggest starting with 20-25 bp primers.
- The Tm of each primer is between 55-65 °C
- The GC content of each primer is between 40-60%
- The Tm of both primers are very similar, i.e., within ~2 °C
- The GC content of both primers are very similar, i.e., within ~5 %
- Either primer will not form a stable internal hairpin structure, i.e., ΔG <-3 kcal/mol
- Either primer will not form a stable dimer with itself, i.e., ΔG <-3 kcal/mol
- The forward and reverse primers do not combine to form a stable hairpin structure or dimer
- If possible the 3' end of each primer should end with a GC
- BioBrick Parts
- Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
- I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
- The Biobrick part starts with a start codon (ATG) and ends with two consecutive stop codons (TAATAA).
- Then the forward primer should be of the form
- 5' CCTTTCTAGAG (15-20 bp of the coding strand, starting ATG) 3'
- 5' CCTTTCTAGAG (15-20 bp of the coding strand, starting ATG) 3'
- and the reverse primer should be of the form:
- 5' AAGGCTGCAGCGGCCGCTACTAGTA (15-20 bp reverse complement, starting TTATTA) 3'
- 5' AAGGCTGCAGCGGCCGCTACTAGTA (15-20 bp reverse complement, starting TTATTA) 3'
- Here there are a four nucleotides (in italics) flanking the restriction sites (in bold); such spacers are required to allow the restriction enzymes to cut properly.
- BioFusion Parts
- Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
- I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
- The insert for the forward primer does not begin with TC (or else a DAM I site (GATC) is formed, and XbaI cannot cut).
- The Biofusion construction does not begin with a start codon, nor does it end with a stop codon.
- Then, the forward primer should be of the form:
- 5' CCTTTCTAGA (15-20 bp of the coding strand) 3'
- 5' CCTTTCTAGA (15-20 bp of the coding strand) 3'
- and the reverse primer should be of the form:
- 5' AAGGCTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3'
- 5' AAGGCTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3'
- Here there are a four nucleotides (in italics) flanking the restriction sites (in bold); such spacers are required to allow the restriction enzymes to cut properly.
- Note: if it is not possible to make a good set of primers with the flanking regions described above, try changing the first 4 bases - which are external to the restriction site - of each primer, e.g.
5' AAGGTCTAGA (15-20 bp of the coding strand) 3'
- Note: if you are still not able to get a good set of primers, try using a completely different set of flanking regions to improve the primers. For example, you can also use a PCR product that has the EcoRI, NotI, and XbaI sites upstream of your part, while the SpeI site is downstream of your part. In this case, the forward primer would be of the form: 5' CCTTGAATTCGCGGCCGCATCTAGA (15-20 bp complement to coding strand)3' and the reverse primer should be of the form:
5' AAGGACTAGT (15-20 bp complement to coding strand) 3'.
- Note: if it is not possible to make a good set of primers with the flanking regions described above, try changing the first 4 bases - which are external to the restriction site - of each primer, e.g.
- If you are installing restriction sites at the ends of the pcr product so that the pcr fragment can be digested and ligated into a plasmid
- ensure that the amplified region does not include the restriction enzymes which you will digest with in your next step.
- include a few nucleotides followed by your restriction sites as 5'flanking regions (regions which are at the 5' primer end, but are not complementary to the template) to your primer.
Designing Primers Using Vector NTI
An easy way to design primers is to use Vector NTI.
- Find the genomic DNA sequence that you want to amplify as your part at yeastgenome.org and save it into Vector NTI.
- Highlight the sequence that you want as your part, and select Analyses -> Primer Design -> Amplify Selection.
- Under the Primer tab, set "Before" and "After" to 0 bp. Adjust the Tm, primer length, GC content, et c. as noted above. Also click More>> and insert the flanking sense and anti-sense sequences (given at top) in the boxes "Attach to 5' terminus of Sense primer" and "Attach to 5' terminus of Anti-sense primer". Lastly, click "Apply" then "OK."
- Three possible sets of designed primers will appear in a folder on the left side of the screen, ranked by their score. Usually, the best possible score is 171. The lowest score that I (Caroline) have successfully used is ~110.
- If the score is poor, look at the individual primer attributes to determine why this is and adjust the input conditions appropriately.
- If the two primers have very different GC content, try altering the flanking sequences to equalize the GC content.
- If the Tm is low, increase the minimum and maximum length of the primers. Vector NTI typically does not scan all possible primer lengths; this forces it to search longer lengths.
- Double-check your primers for hairpins & dimers by highlighting a given sequence, then right-clicking and selecting "Analyze".
- For more information, check out Vector NTI's user manual, Chapters 8 and 20.
- Order 25 nmol DNA oligo with standard desalting from IDT.
PCR from genomic DNA or a plasmid template
Both are known to work. My two cents (Caroline): Using Vent (condition A) works for most (>90%) parts. However, there have been few parts for which I couldn't get pcr products using condition A. I have been able to pcr out these difficult parts using Pfx (condition B) -- Pfx has worked for *all* pcr reactions I've tried.
Condition A: Vent polymerase
- Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
- Mix, adding the enzyme last:
- 5 µL 10x ThermoPol buffer
- 0.4 µL 25 mM dNTPs
- 0.5 µL 100 µM forward primer
- 0.5 µL 100 µM reverse primer
- ≤1 µL plasmid DNA or 2 µL genomic DNA
- 1 µL Vent DNA polymerase
- distilled water to 50 µL total volume
- PCR program:
- Start: 95 °C for 2 min. (melt)
- Cycle 95 °C for 0.5 min (melt)
- Tm minus 5 °C for 0.5 min. (anneal)
- 74 °C for (# bp/1000) min. (extension) - no less than 0.5 min.
- No. of Cycles: 30
- End: keep at 4 °C forever
Condition B: Pfx Polymerase
Materials Required
Procedure
- Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
- Use Invitrogen's Pfx polymerase (Invitrogen catalog #11708-013).
- Mix, adding the enzyme last:
- 3 µL primer mix (10µM of each primer)
- I typically make this primer mix by adding 1 µL of the 100 µM forward primer, 1 µL of the 100 uM forward primer, and 8 µL of sterile water.
- 0.8 µL template DNA
- 25 µL 10X PFx amplification buffer
- 3 µL 10mM dNTPs (each dNTP is 10 mM)
- 2 µL 50mM MgSO4
- 30 µL 10X PFx enhancer buffer
- 34.2 µL water (to 100 µL)
- 2 µL PFx DNA polymerase
- 3 µL primer mix (10µM of each primer)
- PCR Program
- Start: 94 °C for 5 min. (melt)
- Cycle 94 °C for 15 sec (melt) (cycle start)
- 55 °C for 0.5 min. (anneal)
- 68 °C for 1 min/kb (no less than 0.5 min) (extension) (cycle end)
- 68 °C for 7 min
- No. of Cycles: 35
- End: keep at 4 °C forever
C. Optional: Restriction Digest
- If you are going to digest your PCR product for ligation into a plasmid, I recommend doing this before doing gel analysis. Doing the digest before the gel analysis will not allow you to identify cut vs. uncut DNA (typically this is only a few bp difference), but it will allow you to exclude any spurious PCR products that contain those restriction sites.
- See restriction digest page for a detailed procedure of digesting PCR products.
D. Gel analysis and purification of PCR products
- Run the (digested) PCR reaction on an appropriate percentage agarose gel.
- Image the gel, and identify the bands of interest.
- Cut out the band of interest.
- Wear a lab coat, gloves, and UV-protective googles to avoid accidental UV exposure, i.e. a bad sunburn.
- If using the Chemi Doc, slide out the UV transilluminator completely & insert the plexiglass protective shield in the holder at the front of the tray.
- Using a disposable scalpel, cut as small a piece of gel as possible that contains the central DNA band region. Be conservative.
- Using tweezers, place the gel pieces into labeled tubes.
- Image the gel after you cut and remove the bands. This image documents that you cut out the correct band.
- Gel extract the DNA using Qiagen's PCR purification kit. Use the instructions for gel purification, and elute with 30 µL.
- If you end up with a reasonable chunk of gel, measure its weight in advance of doing the purification, and follow the guidelines for how much buffer to dissolve the gel in. If you do not, agarose (we suspect) can end up precipitating in your 'purified' DNA.
- Measure the A260/A280 ratio of your purified DNA. It should be ~1.5 . If it is ~1.0, re-purify the DNA by doing an additional PCR purification.


