NanoBio: PCR
From OpenWetWare
(Difference between revisions)
(→A. Primer design for PCR) |
(→B. PCR from genomic DNA or a plasmid template) |
||
| Line 44: | Line 44: | ||
*Note: if you are still not able to get a good set of primers, try using a completely different set of flanking regions to improve the primers. For example, you can also use a PCR product that has the EcoRI, NotI, and XbaI sites upstream of your part, while the SpeI site is downstream of your part. In this case, the forward primer would be of the form: 5' ''CCTT'''''GAATTCGCGGCCGCATCTAGA''' (15-20 bp complement to coding strand)3' and the reverse primer should be of the form: <br> 5' ''AAGG'''''ACTAGT''' (15-20 bp complement to coding strand) 3'. | *Note: if you are still not able to get a good set of primers, try using a completely different set of flanking regions to improve the primers. For example, you can also use a PCR product that has the EcoRI, NotI, and XbaI sites upstream of your part, while the SpeI site is downstream of your part. In this case, the forward primer would be of the form: 5' ''CCTT'''''GAATTCGCGGCCGCATCTAGA''' (15-20 bp complement to coding strand)3' and the reverse primer should be of the form: <br> 5' ''AAGG'''''ACTAGT''' (15-20 bp complement to coding strand) 3'. | ||
| - | == | + | == PCR from genomic DNA or a plasmid template == |
Both are known to work. | Both are known to work. | ||
Revision as of 17:27, 28 March 2008
DESIGN & PREPARATION OF PCR PRODUCTS AS INSERTS ~ 85 BP AND LARGER: PRIMER AMPLIFICATION OF DNA
Contents |
Primer design for PCR
- General Design considerations. Make sure that:
- The primer length is between 15-30 bp. I suggest starting with 20-25 bp primers.
- The Tm of each primer is between 55-65 °C
- The GC content of each primer is between 40-60%
- The Tm of both primers are very similar, i.e., within ~2 °C
- The GC content of both primers are very similar, i.e., within ~5 %
- Either primer will not form a stable internal hairpin structure, i.e., ΔG <-3 kcal/mol
- Either primer will not form a stable dimer with itself, i.e., ΔG <-3 kcal/mol
- The forward and reverse primers do not combine to form a stable hairpin structure or dimer
- If possible the 3' end of each primer should end with a GC
- BioBrick Parts
- Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
- I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
- The Biobrick part starts with a start codon (ATG) and ends with two consecutive stop codons (TAATAA).
- Then the forward primer should be of the form
- 5' CCTTTCTAGAG (15-20 bp of the coding strand, starting ATG) 3'
- 5' CCTTTCTAGAG (15-20 bp of the coding strand, starting ATG) 3'
- and the reverse primer should be of the form:
- 5' AAGGCTGCAGCGGCCGCTACTAGTA (15-20 bp reverse complement, starting TTATTA) 3'
- 5' AAGGCTGCAGCGGCCGCTACTAGTA (15-20 bp reverse complement, starting TTATTA) 3'
- BioFusion Parts
- Ensure that the genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, or XbaI sites.
- I typically create a PCR product which has an XbaI site upstream of the part, and SpeI, NotI, and PstI sites downstream of the part.
- The insert for the forward primer does not begin with TC (or else a DAM I site (GATC) is formed, and XbaI cannot cut).
- The Biofusion construction does not begin with a start codon, nor does it end with a stop codon.
- Then, the forward primer should be of the form:
- 5' CCTTTCTAGA (15-20 bp of the coding strand) 3'
- 5' CCTTTCTAGA (15-20 bp of the coding strand) 3'
- and the reverse primer should be of the form:
- 5' AAGGCTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3'
- 5' AAGGCTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3'
Here there are a four nucleotides (in italics) flanking the restriction sites (in bold); such spacers are required to allow the restriction enzymes to cut properly.
- If you are installing restriction sites at the ends of the pcr product so that the pcr fragment can be digested and ligated into a plasmid
- ensure that the amplified region does not include the restriction enzymes which you will digest with in your next step.
- include a few nucleotides followed by your restriction sites as 5'flanking regions (regions which are at the 5' primer end, but are not complementary to the template) to your primer.
- An easy way to design primers is to use Vector NTI.
- Find the genomic DNA sequence that you want to amplify as your part at yeastgenome.org and save it into Vector NTI.
- Highlight the sequence that you want as your part, and select Analyses -> Primer Design -> Amplify Selection.
- Under the Primer tab, set "Before" and "After" to 0 bp. Adjust the Tm, primer length, GC content, et c. as noted above. Also click More>> and insert the flanking sense and anti-sense sequences (given at top) in the boxes "Attach to 5' terminus of Sense primer" and "Attach to 5' terminus of Anti-sense primer". Lastly, click "Apply" then "OK."
- Three possible sets of designed primers will appear in a folder on the left side of the screen, ranked by their score. Usually, the best possible score is 171. The lowest score that I (Caroline) have successfully used is ~120.
- Double-check your primers by highlighting a given sequence, then right-clicking and selecting "Analyze".
- For more information, check out Vector NTI's user manual, Chapters 8 and 20.
- Order 25 nmol DNA oligo with standard desalting from IDT.
- Note: if it is not possible to make a good set of primers with the flanking regions described above, try changing the first 4 bases - which are external to the restriction site - of each primer, e.g.
5' AAGGTCTAGA (15-20 bp of the coding strand) 3'
- Note: if you are still not able to get a good set of primers, try using a completely different set of flanking regions to improve the primers. For example, you can also use a PCR product that has the EcoRI, NotI, and XbaI sites upstream of your part, while the SpeI site is downstream of your part. In this case, the forward primer would be of the form: 5' CCTTGAATTCGCGGCCGCATCTAGA (15-20 bp complement to coding strand)3' and the reverse primer should be of the form:
5' AAGGACTAGT (15-20 bp complement to coding strand) 3'.
PCR from genomic DNA or a plasmid template
Both are known to work. My two cents (Caroline): Using Vent (condition A) works for most (>90%) parts. However, there have been few parts for which I couldn't get pcr products using condition A. I have been able to pcr out these difficult parts using Pfx (condition B) -- Pfx has worked for *all* pcr reactions I've tried.
Condition A: Vent polymerase
- Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
- Mix:
- 5 µL 10x ThermoPol buffer
- 0.4 µL 25 mM dNTPs
- 0.5 µL 100 µM forward primer
- 0.5 µL 100 µM reverse primer
- ≤1 µL plasmid DNA or 2 µL genomic DNA
- 1 µL Vent DNA polymerase
- distilled water to 50 µL total volume
- PCR program:
- Start: 95 °C for 2 min. (melt)
- Cycle 95 °C for 0.5 min (melt)
- Tm minus 5 °C for 0.5 min. (anneal)
- 74 °C for (# bp/1000) min. (extension) - no less than 0.5 min.
- No. of Cycles: 30
- End: keep at 4 °C forever
Condition B: Pfx Polymerase
- Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
- Use Stratagene's Pfx kit.
- Mix:
- 3 µL primer mix (10µM of each primer)
- 0.8 µL template DNA
- 25 µL 10X PFx amplification buffer
- 3 µL 10mM dNTPs
- 2 µL 50mM MgSO4
- 30 µL 10X PFx enhancer buffer
- 34.2 µL water (to 100 µL)
- 2 µL PFx DNA polymerase
- PCR Program
- Start: 94 °C for 5 min. (melt)
- Cycle 94 °C for 15 sec (melt) (cycle start)
- 55 °C for 0.5 min. (anneal)
- 68 °C for 1 min/kb (no less than 0.5 min) (extension) (cycle end)
- 68 °C for 7 min
- No. of Cycles: 35
- End: keep at 4 °C forever
C. Gel analysis and purification of PCR products
- Run the PCR reaction on an appropriate percentage agarose gel
- Cut out the band of interest and purify using Qiagen's PCR purification kit. Elute with 30 µL.


