Mesoplasma florum: Tn5 Transposase - Revision history

Endy: /* Tn5 Transposase production */

Endy — Wed, 12 Oct 2011 06:02:46 GMT

Tn5 Transposase production

←Older revision		Revision as of 06:02, 12 October 2011
Line 1:		Line 1:
	{{back to protocols}}		{{back to protocols}}
	==Tn5 Transposase production==		==Tn5 Transposase production==
-	Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre ~~at ridiculously high price~~. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.	+	Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.

	===Materials===		===Materials===

Tk: /* References */

Tk — Wed, 12 Jan 2011 00:06:16 GMT

References

←Older revision		Revision as of 00:06, 12 January 2011
Line 141:		Line 141:
	===References===		===References===
	* [http://www.neb.com/nebecomm/products/productE6900.asp NEB IMPACT-CN web page]		* [http://www.neb.com/nebecomm/products/productE6900.asp NEB IMPACT-CN web page]
-	* [http://www.~~science.mcmaster~~.ca~~/biochem/faculty/andrews/lab/projects/methodsandprograms~~/labman/~~impact_system~~.~~htm McMaster University Impact~~ web site]	+	* [http://www.dwalab.ca/labman/index.html Andrews Lab web site]
	* Goryshin00		* Goryshin00
	* Goryshin98		* Goryshin98

Tk: /* Protocol */

Tk — Mon, 10 Jan 2011 21:22:42 GMT

Protocol

←Older revision		Revision as of 21:22, 10 January 2011
Line 23:		Line 23:

	===Protocol===		===Protocol===
-	* Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture.	+	* Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture overnight
-	* Inoculate ~~2 liters~~ of LB/Cm/Amp culture medium with the culture and grow ~~overnight~~ at ~~23°C~~	+	** Grow in 35 ug/ml chloramphenicol and 100 ug/ml carbenicillin
-	* Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 5 hours	+	* Centrifuge and remove the supernatent to eliminate beta-lactamase from the medium.
-	* ~~Spin~~ down cultures and resuspend in 50 ml ~~TEGX buffer/original liter,~~ transferring to 50 ml centrifuge tubes	+	* Inoculate 1 liter of LB/Cm/Amp culture medium with the culture and grow for 5-6 hours at 25 C until OD 0.5
-	* Spin down a second time and resuspend in 10 ml~~/original liter~~ TEGX + Roche Complete protease inhibitor	+	* Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 3-5 hours
		+	* Split and spin down cultures and resuspend in 80 ml cold water transferring to 50 ml centrifuge tubes
		+	* Spin down a second time and resuspend in 2 x 5 ml cold TEGX + Roche Complete protease inhibitor
	* Sonicate 3x pausing 10 minutes between sonications with the cells on ice		* Sonicate 3x pausing 10 minutes between sonications with the cells on ice
-	* Centrifuge to remove cell debris	+	* Centrifuge at 4C to remove cell debris - 1 hour at 16,000 x g
	* Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads)		* Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads)
-	* Wash the column with 100 ml TEGX buffer	+	* Wash the column with 100 ml cold TEGX buffer
	* Load the cell supernatent onto the column and allow it to flow through		* Load the cell supernatent onto the column and allow it to flow through
	* Flow the supernatent past the column a second time		* Flow the supernatent past the column a second time
Line 39:		Line 41:
	* Cap the column and hold at 4°C overnight		* Cap the column and hold at 4°C overnight
	* Recover the protein with 10 ml TEGX buffer flowed through the column		* Recover the protein with 10 ml TEGX buffer flowed through the column
		+	* Recover a second 10 ml similarly
	* Concentrate the protein by spinning in Centricon YM10		* Concentrate the protein by spinning in Centricon YM10
	* Dilute concentrate with 40% glycerol to bring final to 50%		* Dilute concentrate with 40% glycerol to bring final to 50%

Tk: /* Protocol */

Tk — Thu, 09 Dec 2010 17:09:31 GMT

Protocol

←Older revision		Revision as of 17:09, 9 December 2010
Line 25:		Line 25:
	* Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture.		* Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture.
	* Inoculate 2 liters of LB/Cm/Amp culture medium with the culture and grow overnight at 23°C		* Inoculate 2 liters of LB/Cm/Amp culture medium with the culture and grow overnight at 23°C
-	* Induce cultures at OD 0.5 with ~~50 mM~~ IPTG and grow an additional 5 hours	+	* Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 5 hours
	* Spin down cultures and resuspend in 50 ml TEGX buffer/original liter, transferring to 50 ml centrifuge tubes		* Spin down cultures and resuspend in 50 ml TEGX buffer/original liter, transferring to 50 ml centrifuge tubes
	* Spin down a second time and resuspend in 10 ml/original liter TEGX + Roche Complete protease inhibitor		* Spin down a second time and resuspend in 10 ml/original liter TEGX + Roche Complete protease inhibitor

Tk: /* Protocol */

Tk — Fri, 16 Apr 2010 02:58:29 GMT

Protocol

←Older revision		Revision as of 02:58, 16 April 2010
Line 35:		Line 35:
	* Flow the supernatent past the column a second time		* Flow the supernatent past the column a second time
	* Wash the column with 200 ml TEGX buffer		* Wash the column with 200 ml TEGX buffer
-	* Add 1 ml of 1M ~~IPTG~~ to 20 ml of TEGX buffer	+	* Add 1 ml of 1M DTT to 20 ml of TEGX buffer
-	* Flow the 20 ml ~~IPTG~~ + TEGX into the column	+	* Flow the 21 ml DTT + TEGX into the column
	* Cap the column and hold at 4°C overnight		* Cap the column and hold at 4°C overnight
	* Recover the protein with 10 ml TEGX buffer flowed through the column		* Recover the protein with 10 ml TEGX buffer flowed through the column

Torsten Waldminghaus at 17:13, 23 February 2009

Torsten Waldminghaus — Mon, 23 Feb 2009 17:13:29 GMT

←Older revision		Revision as of 17:13, 23 February 2009
Line 1:		Line 1:
		+	{{back to protocols}}
	==Tn5 Transposase production==		==Tn5 Transposase production==
	Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre at ridiculously high price. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.		Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre at ridiculously high price. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.

Tk: /* References */

Tk — Sat, 05 Apr 2008 23:54:18 GMT

References

←Older revision		Revision as of 23:54, 5 April 2008
Line 142:		Line 142:
	* Kostner06		* Kostner06
	* [http://epibio.com/item.asp?ID=292 Epicenter EZ-TN transposase]		* [http://epibio.com/item.asp?ID=292 Epicenter EZ-TN transposase]
		+	* Hank Daum at Epicentre, hank.daum@epibio.com


	[[category:Mesoplasma florum]][[category:protocol]]		[[category:Mesoplasma florum]][[category:protocol]]

Tk: /* To Do */

Tk — Sat, 05 Apr 2008 20:38:25 GMT

To Do

←Older revision		Revision as of 20:38, 5 April 2008
Line 88:		Line 88:

	===To Do===		===To Do===
-	* Prep new Tn5 protein	+	* Prep new Tn5 protein (on hold, unnecessary)
-	* quantitate existing stock with BSA dilution and gel	+	* quantitate existing stock with BSA dilution and gel (done, spec readings approximately correct)
-	* Make storage buffer, dilute existing stock into storage buffer	+	* Make storage buffer, dilute existing stock into storage buffer (done)
-	* run Goryshin00 style test of transposome formation	+	* run Goryshin00 style test of transposome formation (to do; initial gel unconvincing)
-	* Run Goryshin98 style test of transposon cutting	+	* Run Goryshin98 style test of transposon cutting (to do)
-	* Try transforming E. coli cells	+	* Try transforming E. coli cells (done, this is what counts, compared to Epicentre enzyme is OK)

	===pWH1891 Sequence information===		===pWH1891 Sequence information===

Tk at 20:36, 5 April 2008

Tk — Sat, 05 Apr 2008 20:36:30 GMT

←Older revision		Revision as of 20:36, 5 April 2008
Line 123:		Line 123:
	</code>		</code>

-	==Testing the transposase==	+	===Testing the transposase===

	* Transform 50 μl of E. coli Top10 electrocompetent cells with:		* Transform 50 μl of E. coli Top10 electrocompetent cells with:

Tk at 20:36, 5 April 2008

Tk — Sat, 05 Apr 2008 20:36:05 GMT

←Older revision		Revision as of 20:36, 5 April 2008
Line 122:		Line 122:
	TAATGGCGGATGGGTCTATGA		TAATGGCGGATGGGTCTATGA
	</code>		</code>
		+
		+	==Testing the transposase==
		+
		+	* Transform 50 μl of E. coli Top10 electrocompetent cells with:
		+	** Tn5 transposons (1 μl); plate out on Tet plates, count colonies
		+	** pUC19 positive control 10 pg/μl; plate out on amp plates
		+	** Electroporation at 2.5 KV in 2 mm gap cuvette
		+	** pUC19 colonies visible in six hours under the microscope
		+	** Tet resistant colonies are not visible at that time

	===Notes===		===Notes===