Julius B. Lucks/Antisense RNA Transcription Attenuation/Kinefold Results: Difference between revisions
(corrected RNAI sequence) |
(�corrected RNAI size) |
||
Line 11: | Line 11: | ||
=== RNAI === | === RNAI === | ||
* | * 85nt | ||
* sequence: AUACAAGAUUAUAAAAACAACUCAGUGUUUUUUUCUUUGAAUGAUGUCGUUCACAAACUUUGGUCAGGGCGUGAGCGACUCCUU | * sequence: AUACAAGAUUAUAAAAACAACUCAGUGUUUUUUUCUUUGAAUGAUGUCGUUCACAAACUUUGGUCAGGGCGUGAGCGACUCCUU |
Revision as of 19:57, 31 January 2008
Goal
Test wether or not the Kinefold RNA folding program produces the experimentally determined folds of RNAII/RNAIII. If this is true, then use it to identify a target region that we could mutate that would not drastically affect the secondary structure of RNAIII/II.
Kinefold is an RNA folding program that uses a kinetic, rather than a thermodynamic algorithm. It is thus able to identify kinetically trapped RNA folds, and able to incorporate pseudoknots. See http://kinefold.curie.fr for more information.
Initial Test
In (S Brantl, E G Wagner Mol Microbiol (2000) vol. 35 (6) pp. 1469-82), took sequence of RNAI (antisense RNA), and repC-RNA_132 (intermediate target RNA that looks like in the middle of the 2 hairpin, and the non-attenuateable fold. Folded in kinefold.
- both RNAI and RNAII affective at attenuation - RNAI shorter
RNAI
- 85nt
- sequence: AUACAAGAUUAUAAAAACAACUCAGUGUUUUUUUCUUUGAAUGAUGUCGUUCACAAACUUUGGUCAGGGCGUGAGCGACUCCUU