Jessica Karen Wong/Notebook/2007-7-13

From OpenWetWare
Revision as of 10:02, 16 July 2007 by Jessica Karen Wong (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search
Gel from 7/13/07


I2057

  • Colony PCRed 12 10ul reactions w/ VF and VR, Taq and 1:30 ext time
  • Ran gel (lad, 1-12, 1x DNA, 3x dilution DNA, water, lad)
  • Got lots of too small bands


Sequencing

  1. E0240-1AK3 for E0040VR
  2. E0240-1AK3 for E0040VF
  3. T9002-3K3 for F2620 aka C62 VF
  4. T9002-3K3 for C62VR

E0240

  • Redid gradient BB PCR with 3x dilution and pos control P1010-1AK3 at 52.7

I2055

  • Redigested I2055 w/ pcr'ed in promoter w/ mfe and nsi
    • used 4ul dna and buffer 2
  • ligated I2055 M/N (not sure if contains promoter) and 3K3
  • Transformed 3ul of ligation and plated



Ordered new I2056 primers to PCR in Promoter

  • I2056_R0040_F 8mer.Mfe1.promoter+mix.part of RFP
  • CTTAGTAG CAATTG tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactag ATGGCTTCCTCCGAAGACG (54.0)

Did an overnight colony PCR of

  • T9002 1AK3 (9 samples)
  • T9002 3K3 (16 samples)
  • E0240 3K3 (20 samples)
  • I2055 1AK3 (20 samples)
Retrieved from "https://openwetware.org/mediawiki/index.php?title=Jessica_Karen_Wong/Notebook/2007-7-13&oldid=130581"