IGEM:UW/2008/Notebook/iGEM UW Team/2008/05/22: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 6: | Line 6: | ||
| colspan="2"| | | colspan="2"| | ||
1. Design of | 1. Design of primers for sequencing something we want from pMPM-T5 | ||
Primers: | |||
pMPMT5seqF CTACTGTTTCTCCATACCCG | pMPMT5seqF CTACTGTTTCTCCATACCCG | ||
Revision as of 01:24, 12 June 2008
 University of Warsaw iGEM Team 2008
|
<html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
|
1. Design of primers for sequencing something we want from pMPM-T5 Primers: pMPMT5seqF CTACTGTTTCTCCATACCCG pMPMT5seqR GAAAATCTTCTCTCATCCGC AIDseqP GCTTCGGCGCATCCTTTTG | |
