IGEM:Peking University/2008/Notebook/Group 2/2008/06/20: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(Autocreate 2008/06/20 Entry for IGEM:Peking_University/2008/Notebook/Group_2) |
|||
Line 5: | Line 5: | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
== | ==Primer design== | ||
* | :'''Primer 1''' | ||
:*Primer name: F-HindIII-Apal-Gal4 | |||
:*Sequence(5'to3'):CCCAAGCTTGGGCCCAAGATGAAGCTACTGTCTTCTATCGAACAA | |||
:*Tm:64.9°C | |||
:'''Primer 2''' | |||
:*Primer name: R-EcoRI-Spel-Gal4 | |||
:*Sequence(5'to3'):GGGGAATTCACTAGTATTTTACTCTTTTTTTGGGTTTGGTGGGGT | |||
:*Tm:61.3°C | |||
==PCR== | |||
{|border="1" cellspacing="0" | |||
|+ '''TITLE: PCR-Budding Yeast Genome-Gal4-phusion polymerase 50*6ul''' | |||
|- | |||
| ||Volume (μL) | |||
|- | |||
|Template (pPT1)||0.5 | |||
|- | |||
|dNTP||1 | |||
|- | |||
|Enzyme||0.5 | |||
|- | |||
|Buffer||10 | |||
|- | |||
|F-HindIII-Apal-Gal4||0.5 | |||
|- | |||
|R-EcoRI-Spel-Gal4||0.5 | |||
|- | |||
|ddH<sub>2</sub>O||37 | |||
|} | |||
::'''conditions''' | |||
{|border="1" cellspacing="0" | |||
|+ | |||
|- | |||
|Temperature||Time Length(0:00:00) | |||
|- | |||
| 98°C||00:30 | |||
|- | |||
| 98°C||00:10||30 cycles | |||
|- | |||
| 57.1,60.4,62.5,64.7,66.9,68.9°C||00:30||30 cycles | |||
|- | |||
| 72°C||01:30||30 cycles | |||
|- | |||
| 72°C||07:00 | |||
|- | |||
| 4°C||Hold | |||
|} | |||
<hr class=divider> | |||
::'''Enzyme cutting-pPT1-XbaI-20 μL''' | |||
{|border="1" cellspacing="0" | |||
|+ | |||
|- | |||
| ||Volumn(μL) | |||
|- | |||
| plasmid||5 | |||
|- | |||
| XbaI||0.2 | |||
|- | |||
| BSA ||2 | |||
|- | |||
| M Buffer||2 | |||
|- | |||
|ddH<sub>2</sub>O||10.8 | |||
|} | |||
<!-- ## Do not edit below this line unless you know what you are doing. ## --> | <!-- ## Do not edit below this line unless you know what you are doing. ## --> | ||
|} | |} |
Revision as of 12:20, 22 July 2008
Group 2 | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | |||||||||||||||||||||||||||||||||||||||||||||
Primer design
PCR
|