IGEM:Paris Bettencourt 2012/Notebooks/Semantic group/day by day//2012/07/27
From OpenWetWare
< IGEM:Paris Bettencourt 2012 | Notebooks | Semantic group | day by day/ | 2012 | 07(Difference between revisions)
(→Designing oligo for PCR Quick Change mutagenesis) |
Current revision (08:24, 13 August 2012) (view source) (→Designing oligo for PCR Quick Change mutagenesis (QCM)) |
||
| (4 intermediate revisions not shown.) | |||
| Line 11: | Line 11: | ||
-> #29 (from #3) & #30 (from #5) | -> #29 (from #3) & #30 (from #5) | ||
| - | ==Designing oligo for PCR Quick Change mutagenesis== | + | ==Designing oligo for PCR Quick Change mutagenesis (QCM)== |
| + | |||
| + | The following oligos anneal with the BB P1003, carried by plasmid pSB1A2. | ||
Oligo 1 Fw PCR QCM : | Oligo 1 Fw PCR QCM : | ||
| Line 22: | Line 24: | ||
To calculate other Tm, you can change/copy/paste in Python the following code : | To calculate other Tm, you can change/copy/paste in Python the following code : | ||
| - | + | ||
| + | N = 36 | ||
gc = 44.4 | gc = 44.4 | ||
mut = 1 | mut = 1 | ||
| Line 29: | Line 32: | ||
which give : | which give : | ||
| - | In [23]: Tm | + | In [23]: Tm |
| - | Out[23]: 78.92622222222222 | + | Out[23]: 78.92622222222222 |
| - | Which is good, since Tm has to be ≥78°C and %GC | + | Which is good, since Tm has to be ≥78°C and %GC > 40% |
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
Current revision
 Project name
|  Main project page Previous entry Next entry
|
pSC008-80°C and -20°C stocks are made ! -> #29 (from #3) & #30 (from #5) Designing oligo for PCR Quick Change mutagenesis (QCM)The following oligos anneal with the BB P1003, carried by plasmid pSB1A2. Oligo 1 Fw PCR QCM : GCGCCGGTTACATTAGATTCCTGTTTGTAATTGTCC Tm = 78.9°C Calculate thanks to the formula given in the kit documentation : To calculate other Tm, you can change/copy/paste in Python the following code : N = 36 gc = 44.4 mut = 1 Tm = 81.5 + 0.41*gc-675/N-((mut*100.0)/N) which give : In [23]: Tm Out[23]: 78.92622222222222 Which is good, since Tm has to be ≥78°C and %GC > 40% |
|
