IGEM:Imperial/2010/Parts: Difference between revisions
(come binding) |
mNo edit summary |
||
(16 intermediate revisions by 5 users not shown) | |||
Line 1: | Line 1: | ||
{{Imperial2010/Header}} | |||
[[/Registry_Upload| Registry Upload]] | |||
==Registry use workshop videos== | ==Registry use workshop videos== | ||
Line 25: | Line 28: | ||
==Biobricks== | ==Biobricks== | ||
[[Image:Biobricks.jpg|700px|thumb|center|alt=A|BBs]] | |||
===AIP fusion protein=== | |||
LytC is a candidate cell wall protein that we could attach the CSP to. The LytC sequence can be found in this [[Image:LytC_sequences.docx | document]]. | |||
Amino acid sequence: | |||
Met R S Y I K V L T Met C F L G L I L F V P T A L A D N S V K R V G G S N R Y G T A V Q I S K Q Met Y S T A S T A V I V G G S S Y A D A I S A A P L A Y Q K N A P L L Y T N S D K L S Y E T K T R L K E Met Q T K N V I I V G G T P A V S S N T A N Q I K S L G I S I K R I A G S N R Y D T A A R V A K A Met G A T S K A V I L N G F L Y A D A P A V I P Y A A K N G Y P I L F T N K T S I N S A T T S V I K D K G I S S T V V V G G T G S I S N T V Y N K L P S P T R I S G S N R Y E L A A N I V Q K L N L S T S T V Y V S N G F S Y P D S I A G A T L A A K K K Q S L I L T N G E N L S T G A R K I I G S K N Met S N F Met I I G N T P A V S T K V A N Q L K N P V V S R G S R A S W P L E Met R L S K F F R D F I L Q R K K H H H H H H Stop Stop | |||
===ComCDE signaling=== | ===ComCDE signaling=== | ||
ComC accession no AAC44895.1, ComD accession no AAC44896.1, ComE accession no AAC44897 | ComC accession no AAC44895.1, ComD accession no AAC44896.1, ComE accession no AAC44897 | ||
The Com operon sequence can be found in this [[Image:Com_operon.doc | word document]]. The individual ComC, ComD and ComE genes, including their flanking sequences can be found in this [[Image:Com_operon_d_and_e_sequences_with_scars_etc.doc | word document]]. More information about the amino acid sequences, including the protein sizes can be found in this [[Image:ComE_and_comD_proteins.doc | document]]. | |||
====ComE binding site==== | ====ComE binding site==== | ||
Line 36: | Line 48: | ||
[[Image:Come_binding.bmp]] | [[Image:Come_binding.bmp]] | ||
This was the consensus sequence from the [http://jb.asm.org/cgi/reprint/186/10/3078 paper] which talks about how BlpR and ComE upregulate transcription of an ABC transporter. | This was the consensus sequence from the [http://jb.asm.org/cgi/reprint/186/10/3078 paper] which talks about how BlpR and ComE upregulate transcription of an ABC transporter. It says; | ||
"The target site of ComE consists of two 9-bp imperfect direct repeats separated by a stretch of 12 nucleotides (34). The consensus sequence of the 9-bp direct repeat is 5-(AGT)CA(GCT)TT(GT)(AG)G-3, where the underlined positions are conserved." | |||
The ComE binding sequence we will use is taken from the ComCDE operon, and is taken from [http://www3.interscience.wiley.com/cgi-bin/fulltext/119079064/PDFSTART Ween ''et al'']: | |||
acactttgggagaaaaaaatgacagttgagagaaattttatctaaaaacgaaattccattttgtatataatggtttttgtaagttagcttacaagaaaaaacatt | |||
Or a smaller ComE binding site is: | |||
atccaaaagtgcagttgggagggagataggctcatttgggaaggaagtccagttttgttagtgattggggtaagatagttgttat | |||
[http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6968.2006.00584.x/pdf Halfman ''et al''] used the promoters (including the ComE binding site) for ComCDE and ComAB to bring about transcription of B-galactosidase. Also, they used the Pveg promoter from ''B. subtilis'' in ''S. pneumoniae'', so there is reason to believe that a promoter from ''S. pneumoniae'' will work in ''B. subtilis''. | |||
We will use the PComC promoter, which has the following sequence: | |||
GCATGCTGGGATCAATATAATAGCAAAGCTGGGAATTTTCCCGGCTTTTTTCTTAAAAAAGTACACTTTGGGAGAAAAAAATGACAGTTGAGAGAATTTTATCTAAAACGAAATTCCATTTTGTATAATGGTTTTTGTAAGTTGGATCC | |||
They took out the inverted repeats at the 3' end, and instead added a BamHI site. | |||
[http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2958.2010.07071.x/full Martin ''et al''] established that instead of a basal level of transcription of genes controlled by ComE binding, there was just read-through from other genes. This means that because we are taking the promoter out of context, the basal level of transcription is unlikely to occur. | |||
====LacI==== | |||
LacI consensus binding sites [[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WK7-45SJC16-1Y&_user=217827&_coverDate=04%2F18%2F1997&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=4a792890b48df7c099335f4cbdc7febd]] | |||
20 bp symmetric Lac Operator (Osym) | |||
AATTGTGAGC GCTCACAATT |
Latest revision as of 06:39, 13 October 2010
<html>
<head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript"> $(document).ready(function(){
$(function(){
var path = location.pathname.substring(1); if ( path ) $('#headover ul li a[href$="' + path + '"]').addClass("curlink").css("color","#ea8828");; var vCurlink = $('#headover ul li a[href$="' + path + '"]').attr("id"); $('#'+vCurlink+'.listhead').addClass('curlink').css("color","#444444");
});
$('#menuback').mouseover(function() {
$('#headover').stop().animate({height:'150px',top:'0px'},1000);
});
$('#menu').mouseleave(function() {
$('.listhead').not('.curlink').css("color","#ffffff"); $('.listmain').not('.curlink').css("color","#dddddd"); $('#headover ul').fadeOut(200); $('#headover').stop().animate({height:'50px',top:'100px'},1000);
});
$('.listhead').mouseover(function(){
$('.listhead').not('.curlink').css("color","#ffffff"); $(this).css("color","#444444"); $('#headover ul').css("display","none"); var vActive = $(this).attr("id"); $('.'+vActive).stop().fadeIn(200);
});
$('.listmain').mouseover(function(){
$('.listmain').not('.curlink').css("color","#dddddd"); $(this).css("color","#ea8828");
});
$('#headover').mouseleave(function(){
$('.listmain').not('.curlink').css("color","#dddddd");
});
}); </script> <style type="text/css">
.firstHeading { display: none;}
#content { width: 900px; font-family: helvetica, arial, sans-serif; color: #555555}
#title { width:900px; height:50px; position: relative; top: 0px; left: 0px;}
#implogo { width:190px; height:50px; position: absolute; top: 0px; left: 20px; background-image:url(http://openwetware.org/images/c/c9/Imperialigemimplogo.jpg);}
#igemlogo { width:84px; height:50px; position:absolute; top:0px; left:260px; background-image:url(http://openwetware.org/images/9/9c/Imperialigemigemlogo.jpg);}
#csynbilogo { width:205px; height:50px; position:absolute; top:0px; left:394px; background-image:url(http://openwetware.org/images/a/ac/Imperialigemcsynbilogo.jpg);}
#menu { width:900px; height:150px; position: relative; top: 20px; left: 0px;}
#menuback { width:100px; height:150px; position: absolute; top: 0px; left: 0px; background-color: #ea8828}
#headpic { width:800px; height:150px; position: absolute; top: 0px; left: 100px; background-image: url('http://openwetware.org/images/5/54/Imperialigemheadone.jpg'); }
#headover { width: 800px; height:50px; position: absolute; top: 100px; left: 0px; background: url(http://openwetware.org/images/d/d8/Imperialigemheadoverone.png) 0px 0px no-repeat; }
a { outline:none;}
#headtit{ font-family: helvetica, arial, sans-serif; font-size: 1.2em; color: #ffffff; position: absolute; top: 0.5em; right: 1.4em;}
.dark{ color: #dddddd;}
.highlight{ color: #ea8828;}
#menulist{ position: absolute; top: 16px; left: 3px; list-style: none;}
#menulist li{ height: 30px; }
#menulist li a{ font-weight: 100; font-size: 1.2em; text-decoration: none; font-family: helvetica, arial, sans-serif; color: #ffffff;}
#headover ul{ list-style: none; display: none; position: absolute; top: 1.2em; left: 0.2em; }
#headover ul ul{ position: absolute; top:-0.2em; left: 15em;}
#headover ul li{ height: 2.4em; }
#headover ul li a{ font-weight: 100; font-size: 1.2em; text-decoration: none; font-family: helvetica, arial, sans-serif; color: #dddddd;}
</style> </head> <body> <div id='title'> <div id='implogo'> </div> <div id='igemlogo'> </div> <div id='csynbilogo'> </div> </div> <div id='menu'> <div id='menuback'> <ul id='menulist'> <li><a href='#' class='listhead' id='project'>Project</a></li> <li><a href='#' class='listhead' id='plan'>Plan</a></li> <li><a href='#' class='listhead' id='results'>Results</a></li> <li><a href='#' class='listhead' id='extra'>Extra</a></li> </ul> </div> <div id='headpic'> <div id='headover'> <p id='headtit'>Parasight<span class='dark'> <span class='highlight'>|</span> Parasite detection with a rapid response</span></p> <ul class='project'> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010' class='listmain' id='project'>Overview</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Detection_module' class='listmain' id='project'>Detection Module</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Fast_Response_module' class='listmain' id='project'>Fast Response Module</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Output_module' class='listmain' id='project'>Output Module</a></li> <ul class='project'> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Ethics' class='listmain' id='project'>Ethics</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Parts' class='listmain' id='project'>Parts</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Papers' class='listmain' id='project'>Papers</a></li> </ul> </ul> <ul class='plan'> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Strategy' class='listmain' id='plan'>Strategy</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Parts/Synthesis' class='listmain' id='plan'>Synthesis</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Lab_Work' class='listmain' id='plan'>Lab Work</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Protocol' class='listmain' id='plan'>Protocol</a></li> <ul class='plan'> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Modelling' class='listmain' id='plan'>Modelling</a></li> </ul> </ul> <ul class='results'> <li><a href='#' class='listmain' id='results'>Under Construction</a></li> </ul> <ul class='extra'> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Projects' class='listmain' id='extra'>Brainstorming</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Journal_Club' class='listmain' id='extra'>Journal Club</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Movie_Night' class='listmain' id='extra'>Movie Night</a></li> <li><a href='http://openwetware.org/wiki/IGEM:Imperial/2010/Judging_Criteria' class='listmain' id='extra'>Judging Criteria</a></li> </ul> </div> </div> </div> </body>
</html> <html>
<head> <style type="text/css"> #blank { height:40px; width: 900px; </style> </head> <body> <div id="blank"> </div> </body>
</html>
Registry use workshop videos
The following website contains really good videos that teach how to efficiently use registry. It could be useful to explore these videos before starting the extensive search for coding sequences. It provides answers to:
- 4 searches to choos from - which one should I use?
- how to add parts to registry?
- what are the requirements of judging parts?
- what are the safety concerns?
Chassis Options
Ideally, we would use B. subtilis because it is a well characterised gram positive bacterium that does quorum sensing using small peptides as autoinducers. These small peptides could be produced as a result of cleavage of a membrane-anchored protein by a protease from the parasite which we want to detect.
However, there are issues regarding the extracellular proteases produced by gram positive bacteria. These could interfere with the system and could result in false positives or degrade the protease detection peptide. There are protease deficient strains available that may bypass some of these problems.
Protease detector peptides (small linear quourum sensing peptide attached to protease recognition sequence) may also get trapped between the cell wall and cell membraine. To avoid this we looked into mechanisms of transport and attachment of these peptides to the ouside of cell wall. An alternative is to secrete detector peptides into the medium as B.subtilis is very good at secreting proteins.
Another option is to attach the small protease detector peptides on to pili (fimbriae) that are normally presented on the bacterial cell. This has been done routinely on E.coli fimbriae at non-conserved regions and outer membrane proteins to present various antigens [[1]]. There is also a good review of a variety of export patways that have been used [[2]] in gram negative bacteria. There is a lot work done on gram positive bacteria, although there is a detailed and very accessible review [[3]] of current understanding of G+ve cell surface.
Surpulus information on B. Subtilis chassis Subti-Wiki
E.coli was also considered as a possible option. Despite the G-ve outer membraine, there are strains that have been made more permeable through knockout of Lipid A biosynthesis in lipolysaccharides (lpxA,lpxD [[4]]). There are also proteins that can disrupt membraraines when they are inserted in them, thus making them more permeable. These chages in permeability are likely due to transient ruptures of outer membraine and so unlikely to make a very responsive or robust detecton organism [[5]].
Biobricks
AIP fusion protein
LytC is a candidate cell wall protein that we could attach the CSP to. The LytC sequence can be found in this File:LytC sequences.docx.
Amino acid sequence:
Met R S Y I K V L T Met C F L G L I L F V P T A L A D N S V K R V G G S N R Y G T A V Q I S K Q Met Y S T A S T A V I V G G S S Y A D A I S A A P L A Y Q K N A P L L Y T N S D K L S Y E T K T R L K E Met Q T K N V I I V G G T P A V S S N T A N Q I K S L G I S I K R I A G S N R Y D T A A R V A K A Met G A T S K A V I L N G F L Y A D A P A V I P Y A A K N G Y P I L F T N K T S I N S A T T S V I K D K G I S S T V V V G G T G S I S N T V Y N K L P S P T R I S G S N R Y E L A A N I V Q K L N L S T S T V Y V S N G F S Y P D S I A G A T L A A K K K Q S L I L T N G E N L S T G A R K I I G S K N Met S N F Met I I G N T P A V S T K V A N Q L K N P V V S R G S R A S W P L E Met R L S K F F R D F I L Q R K K H H H H H H Stop Stop
ComCDE signaling
ComC accession no AAC44895.1, ComD accession no AAC44896.1, ComE accession no AAC44897
The Com operon sequence can be found in this File:Com operon.doc. The individual ComC, ComD and ComE genes, including their flanking sequences can be found in this File:Com operon d and e sequences with scars etc.doc. More information about the amino acid sequences, including the protein sizes can be found in this File:ComE and comD proteins.doc.
ComE binding site
ComE binding sites in the promoters of the comCDE and comAB operons:
This was the consensus sequence from the paper which talks about how BlpR and ComE upregulate transcription of an ABC transporter. It says; "The target site of ComE consists of two 9-bp imperfect direct repeats separated by a stretch of 12 nucleotides (34). The consensus sequence of the 9-bp direct repeat is 5-(AGT)CA(GCT)TT(GT)(AG)G-3, where the underlined positions are conserved."
The ComE binding sequence we will use is taken from the ComCDE operon, and is taken from Ween et al: acactttgggagaaaaaaatgacagttgagagaaattttatctaaaaacgaaattccattttgtatataatggtttttgtaagttagcttacaagaaaaaacatt
Or a smaller ComE binding site is: atccaaaagtgcagttgggagggagataggctcatttgggaaggaagtccagttttgttagtgattggggtaagatagttgttat
Halfman et al used the promoters (including the ComE binding site) for ComCDE and ComAB to bring about transcription of B-galactosidase. Also, they used the Pveg promoter from B. subtilis in S. pneumoniae, so there is reason to believe that a promoter from S. pneumoniae will work in B. subtilis.
We will use the PComC promoter, which has the following sequence:
GCATGCTGGGATCAATATAATAGCAAAGCTGGGAATTTTCCCGGCTTTTTTCTTAAAAAAGTACACTTTGGGAGAAAAAAATGACAGTTGAGAGAATTTTATCTAAAACGAAATTCCATTTTGTATAATGGTTTTTGTAAGTTGGATCC
They took out the inverted repeats at the 3' end, and instead added a BamHI site. Martin et al established that instead of a basal level of transcription of genes controlled by ComE binding, there was just read-through from other genes. This means that because we are taking the promoter out of context, the basal level of transcription is unlikely to occur.
LacI
LacI consensus binding sites [[6]]
20 bp symmetric Lac Operator (Osym) AATTGTGAGC GCTCACAATT