IGEM:Imperial/2010/Output module/EGFP
From OpenWetWare
Notes on EGFP
- the N-terminal half of EGFP (1−128 amino acids; light gray) and C-terminal half of EGFP (129−238 amino acids; dark gray), respectively.
- in the article: Interacted protein A and protein B are linked to opposite ends of the split VDE. Interaction between protein A and protein B accelerates the folding of N- and C-terminal VDE and protein splicing occurs. The N- and C-terminal halves of EGFP are linked together by a normal peptide bond to yield the β-can structure (green), in which the fluorophore is formed.
- translation=
MVSKGEELFTGVVPILVELD
GDVNGHKFSVSGEGEGDATY
GKLTLKFICTTGKLPVPWPT
LVTTLTYGVQCFSRYPDHMK
QHDFFKSAMPEGYVQERTIF
FKDDGNYKTRAEVKFEGDTL
VNRIELKG (128aa)
IDFKEDGNILGH
KLEYNYNSHNVYIMADKQKN
GIKVNFKIRHNIEDGSVQLA
DHYQQNTPIGDGPVLLPDNH
YLSTQSALSKDPNEKRDHMV
LLEFVTAAGITLGMDELYK (239aa)
- nucleotide sequence=
61 atgg tgagcaaggg cgaggagctg
121 ttcaccgggg tggtgcccat cctggtcgag ctggacggcg acgtaaacgg ccacaagttc
181 agcgtgtccg gcgagggcga gggcgatgcc acctacggca agctgaccct gaagttcatc
241 tgcaccaccg gcaagctgcc cgtgccctgg cccaccctcg tgaccaccct gacctacggc
301 gtgcagtgct tcagccgcta ccccgaccac atgaagcagc acgacttctt caagtccgcc
361 atgcccgaag gctacgtcca ggagcgcacc atcttcttca aggacgacgg caactacaag
421 acccgcgccg aggtgaagtt cgagggcgac accctggtga accgcatcga gctgaagggc
481 atcgacttca aggaggacgg caacatcctg gggcacaagc tggagtacaa ctacaacagc
541 cacaacgtct atatcatggc cgacaagcag aagaacggca tcaaggtgaa cttcaagatc
601 cgccacaaca tcgaggacgg cagcgtgcag ctcgccgacc actaccagca gaacaccccc
661 atcggcgacg gccccgtgct gctgcccgac aaccactacc tgagcaccca gtccgccctg
721 agcaaagacc ccaacgagaa gcgcgatcac atggtcctgc tggagttcgt gaccgccgcc
781 gggatcactc tcggcatgga cgagctgtac aagtaa
Reference: EGFP on NCBI
- nucleotide sequence: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa
- the bacteria were allowed to express recombinant protein with IPTG for 3 h at 25 °C and 10 μL of LB medium containing the bacteria was streaked onto LB-agarose plates and incubated overnight at 25 °C. The bacteria on the plates were illuminated with blue-LED at 470 nm (LAS-1000plus, Fujifilm), emitting maximum at 510 nm, which was detected by a cooled CCD equipped with an emission filter (530DF30).


