IGEM:Imperial/2010/Output module

From OpenWetWare

Jump to: navigation, search
Effector 1 (Protease) Effector 2 (Dye,Enz) Pigment biosynthetic pathways
transcr sigma 54 2 colourless Bilins
Activation (phosphorylation) Enz-in-pathway
  • short pathways
  • ensure - colourless -> colour
  • short pathways
  • ensure - colourless -> colour
Target proteases to use
  • not many AA
  • non-toxic
  • can work in E.Coli
  • quantize speed, efficiency
Protein scaffold Fret pairs as back up for effectors
2C DNA binding prot release

This review article has some useful information on FRET.


Our autoinhibitory coiled-coil output constructs

Taken and adapted from the JACS article 'An Autoinhibited Coiled-Coil Design Strategy for Split-Protein Protease Sensors' ref

The construct design is of the order:

A’-TEV-B-NFluc Cfluc-A-TEV-B‘2A

Where in our case NFluc and CFluc will be NBlactamase CBlactamase//split eGFP and split TEV itself. The 2A refers to a mutated variation of the original coil sequence (AQLKKKLQANKKELAQLKWKLQALKKKLAQ)which produced a better coil activity.


gcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcag


gcgcaggcgaaaaaaaaagcgcaggcgaacaaaaaagaactggcgcagctgaaatggaaa ctgcaggcgctgaaaaaaaaactggcgcag

Tobacco etch virus (TEV) protease-cleavable linker (GGGGENLYFQGGKLGGGG)was used.

ggcggcggcggcgaaaacctgtattttcagggcggcaaactgggcggcggcggc LINKER

Overall sequence for Coiled-coil construct


ggcggcggcagcggcggcggcagcggcggcggcagcgcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcagggcggcggcggcgaaaacctgtattttcag ggcggcaaactgggcggcggcggcgcgcaggcgaaaaaaaaagcgcaggcgaacaaaaaa gaactggcgcagctgaaatggaaactgcaggcgctgaaaaaaaaactggcgcag


gcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcagggcggcggcggcgaaaacctgtattttcag ggcggcaaactgggcggcggcggcgcgcagctgaaaaaaaaactgcaggcgaacaaaaaa gaactggcgcagctgaaatggaaactgcaggcgctgaaaaaaaaactggcgcagggcggcggcagcggcggcggcagcggcggcggcagc

(GGGS)3 is the flexible linker between the split protease/enzyme and the coil!!

Beta-Lactamase construct

NβLac-A-TEV-B’4A βLactamase (26-196)(Glu) TEV B-CβLac βLactamase (Leu)(198-290)

LacB from pQE32 plasmid [[1]]

Showing sequences for the B-Lactamase, the sequences are split into the two halves with the gap in the middle.




Nucleotide atgagcattcagcattttcgcgtggcgctgattccgttttttgcggcgttttgcctgccggtgtttgcgcatccggaaaccctggtgaaagtgaaagatgcggaagatcagctgggcgcgcgcgtgggctatattgaactggatctgaacagcggcaaaattctggaaagctttcgcccggaagaacgctttccgatgatgagcacctttaaagtgctgctgtgcggcgcggtgctgagccgcattgatgcgggccaggaacagctgggccgccgcattcattatagccagaacgatctggtggaatatagcccggtgaccgaaaaacatctgaccgatggcatgaccgtgcgcgaactgtgcagcgcggcgattaccatgagcgataacaccgcggcgaacctgctgctgaccaccattggcggcccgaaagaactgaccgcgtttctgcataacatgggcgatcatgtgacccgcctggatcgctgggaaccggaactgaacgaagcgattccgaacgatgaacgcgataccaccatgccggtggcgatggcgaccaccctgcgcaaactgctgaccggc



fluorocilin green (Invitrogen) was used as the fluorescing substrate.

Superfolder split GFP

NOTE readily self assembles as does split Beta-galactosidase

'One fragment of the split GFP contains the first 214 residues of the exceptionally stable, fast-folding ‘‘superfolder’’ GFP protein (Pedelacq et al., 2006), further evolved to be stable as a protein fragment. This fragment includes ten of the eleven strands of the beta-barrel structure of GFP and will be called spGFP1-10. The second split-GFP fragment consists of just 16 residues, 215– 230, which make up the 11th strand of the GFP b-barrel. This second fragment, spGFP11, acts as a small protein tag that can be inserted into many different proteins without affecting their solubility' ref

Amino acid and sequence of the GFP 11 cassette:






Re-confirmed sequence for S219D TEV construct


Nucleotide: ggccgcagcctgtttaaaggcccgcgcgattataacccgattagcagcaccatttgccatctgaccaacgaaagcgatggccataccaccagcctgtatggcattggctttggcccgtttattattaccaacaaacatctgtttcgccgcaacaacggcaccctgctggtgcagagcctgcatggcgtgtttaaagtgaaaaacaccaccaccctgcagcagcatctgattgatggccgcgatatgattattattcgcatgccgaaagattttccgccgtttccgcagaaactgaaatttcgcgaaccgcagcgcgaagaacgcatttgcctggtgaccaccaactttcagaccaaaagcatgagcagcatggtgagcgataccagctgcacctttccgagcagcgatggcattttttggaaacattggattcagaccaaagatggccagtgcggcagcccgctggtgagcacccgcgatggctttattgtgggcattcatagcgcgagcaactttaccaacaccaacaactattttaccagcgtgccgaaaaactttatggaactgctgaccaaccaggaagcgcagcagtgggtgagcggctggcgcctgaacgcggatagcgtgctgtggggcggccataaagtgtttatggataaaccggaagaaccgtttcagccggtgaaagaagcgacccagctgatgaac

James- some suggested papers:

  1. Kerppola TK. . pmid:17117150. PubMed HubMed [1]
  2. Wehr MC, Laage R, Bolz U, Fischer TM, Grünewald S, Scheek S, Bach A, Nave KA, and Rossner MJ. . pmid:17072307. PubMed HubMed [2]
All Medline abstracts: PubMed HubMed

GFP as output


Personal tools