IGEM:Imperial/2010/Output module - Revision history

Benjamin Miller at 16:12, 23 September 2010

Benjamin Miller — Thu, 23 Sep 2010 16:12:15 GMT

←Older revision		Revision as of 16:12, 23 September 2010
Line 1:		Line 1:
		+	{{Imperial2010/Header}}
	{\| class="wikitable" style="text-align: center; width: 50%; height: 170px;" border="1"		{\| class="wikitable" style="text-align: center; width: 50%; height: 170px;" border="1"

Harriet D. Gliddon: /* C23O */

Harriet D. Gliddon — Thu, 05 Aug 2010 14:52:20 GMT

C23O

←Older revision		Revision as of 14:52, 5 August 2010
Line 185:		Line 185:
	Catechol 2,3-dioxygenase (also known as C23O or MPC) catalyses the conversion of a colourless substrate (catechol or substituted catechols) into a bright yellow product (2-hydroxymuconic semialdehyde) within seconds of substrate addition.		Catechol 2,3-dioxygenase (also known as C23O or MPC) catalyses the conversion of a colourless substrate (catechol or substituted catechols) into a bright yellow product (2-hydroxymuconic semialdehyde) within seconds of substrate addition.

-	C23O is a homotetramer and its crystal structure has been solved. See [[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6VSR-4CXCWS0-8&_user=217827&_coverDate=01%2F15%2F1999&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=da4c70ba15ab6920ba7b6ec6cebb34cf Kita et al]] or use the accession code 1mpy.	+	C23O is a homotetramer and its crystal structure has been solved. See [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6VSR-4CXCWS0-8&_user=217827&_coverDate=01%2F15%2F1999&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=da4c70ba15ab6920ba7b6ec6cebb34cf Kita et al] or use the accession code 1mpy.

-	C23O has also been expressed successfully in B. subtilis by [[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC393536/?tool=pubmed Zukowski et al]].	+	C23O has also been expressed successfully in B. subtilis by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC393536/?tool=pubmed Zukowski et al].

	We would make a fusion protein by adding, for example, GST to either the C- or N- terminus. This would hopefully prevent oligomerisation until the TEV protease is activated. TEV would specifically cleave the linker between GST and C23O, resulting in C23O monomers that are capable of oligomerising. Homotetramers would then be active and could catalyse the chromogenic reaction.		We would make a fusion protein by adding, for example, GST to either the C- or N- terminus. This would hopefully prevent oligomerisation until the TEV protease is activated. TEV would specifically cleave the linker between GST and C23O, resulting in C23O monomers that are capable of oligomerising. Homotetramers would then be active and could catalyse the chromogenic reaction.
Line 196:		Line 196:
	The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.		The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.

-	However, when we looked at C23O in Pymol, we noticed that the N-termini were probably closer to the oligomerisation interfaces (see below). Also, we were also worried that we might still get dimerisation if we used the N-terminus for our fusion protein. However, [[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6VSR-4CXCWS0-8&_user=217827&_coverDate=01%2F15%2F1999&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=da4c70ba15ab6920ba7b6ec6cebb34cf Kita et al]] show that the projecting loop is needed for dimerisation, and this is very near to the N-terminus.	+	However, when we looked at C23O in Pymol, we noticed that the N-termini were probably closer to the oligomerisation interfaces (see below). Also, we were also worried that we might still get dimerisation if we used the N-terminus for our fusion protein. However, [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6VSR-4CXCWS0-8&_user=217827&_coverDate=01%2F15%2F1999&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=da4c70ba15ab6920ba7b6ec6cebb34cf Kita et al] show that the projecting loop is needed for dimerisation, and this is very near to the N-terminus.

	[[Image:Tetramer of C23O.PNG]]		[[Image:Tetramer of C23O.PNG]]

Harriet D. Gliddon: /* C23O */

Harriet D. Gliddon — Thu, 05 Aug 2010 14:51:22 GMT

C23O

←Older revision		Revision as of 14:51, 5 August 2010
Line 199:		Line 199:

	[[Image:Tetramer of C23O.PNG]]		[[Image:Tetramer of C23O.PNG]]
		+
		+
	The C23O gene is already part of a BioBrick (Part:BBa_K118021).		The C23O gene is already part of a BioBrick (Part:BBa_K118021).

Harriet D. Gliddon: dimerisation and pymol

Harriet D. Gliddon — Thu, 05 Aug 2010 14:50:50 GMT

dimerisation and pymol

←Older revision		Revision as of 14:50, 5 August 2010
Line 194:		Line 194:
	However, it is further away from the oligomerisation interfaces and so might not actually prevent oligomerisation.		However, it is further away from the oligomerisation interfaces and so might not actually prevent oligomerisation.

-	The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.	+	The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.

		+	However, when we looked at C23O in Pymol, we noticed that the N-termini were probably closer to the oligomerisation interfaces (see below). Also, we were also worried that we might still get dimerisation if we used the N-terminus for our fusion protein. However, [[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6VSR-4CXCWS0-8&_user=217827&_coverDate=01%2F15%2F1999&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=da4c70ba15ab6920ba7b6ec6cebb34cf Kita et al]] show that the projecting loop is needed for dimerisation, and this is very near to the N-terminus.
		+
		+	[[Image:Tetramer of C23O.PNG]]
	The C23O gene is already part of a BioBrick (Part:BBa_K118021).		The C23O gene is already part of a BioBrick (Part:BBa_K118021).

Kyasha Sri Ranjan: table of outputs presented on wed 04/08 updated (right at the bottom of the page)

Kyasha Sri Ranjan — Thu, 05 Aug 2010 10:47:20 GMT

table of outputs presented on wed 04/08 updated (right at the bottom of the page)

←Older revision		Revision as of 10:47, 5 August 2010
Line 213:		Line 213:
	* [http://pubs.acs.org/doi/full/10.1021/ac010717k Protein Splicing-Based Reconstitution of Split Green Fluorescent Protein for Monitoring Protein−Protein Interactions in Bacteria: Improved Sensitivity and Reduced Screening Time]		* [http://pubs.acs.org/doi/full/10.1021/ac010717k Protein Splicing-Based Reconstitution of Split Green Fluorescent Protein for Monitoring Protein−Protein Interactions in Bacteria: Improved Sensitivity and Reduced Screening Time]
	* [http://pubs.acs.org/doi/full/10.1021/ac000617z A Fluorescent Indicator for Detecting Protein−Protein Interactions in Vivo Based on Protein Splicing]		* [http://pubs.acs.org/doi/full/10.1021/ac000617z A Fluorescent Indicator for Detecting Protein−Protein Interactions in Vivo Based on Protein Splicing]
		+
		+	==Possible Outputs and their pros and cons==
		+
		+	{\| class="wikitable" style="text-align: center; width: 50%; height: 170px;" border="1"
		+
		+	\|-
		+	! Output !! Substrate !! Pros !!Cons
		+	\|-
		+	\| Split β-lactamase
		+	\|
		+	*Cephalosporin
		+	* Flourocilin green
		+	\|
		+	* Cheap
		+	* β-lac tested and shown to work
		+	* Ceph kills cells
		+	* Visible colour output
		+	\|
		+	* Lyses cells
		+	* Quantification difficult
		+
		+	\|-
		+	\| Split Luciferase
		+	\| Luciferin
		+	\|
		+	* Quantification
		+	\|
		+	* Poor expression
		+	* Expensive
		+	* Lyses cells
		+
		+	\|-
		+	\| Split TEV
		+	\|
		+	* C230-dihydrogenase
		+	\|
		+	* Fast
		+	* Visible colour output (yellow)
		+	* In registry
		+	* Works in B.Sub
		+	* Cheap substrate
		+	\|
		+	* TEV not tested in coils
		+	* Protein engineering
		+	\|-
		+	\| Split TEV
		+	\|
		+	* FRET pair
		+	\|
		+	* Fast
		+	* Established
		+	\|
		+	* TEV not tested in coils
		+	* No visible colour - florescence
		+
		+	\|-
		+	\| Split TEV
		+	\|
		+	* EGFP
		+	\|
		+	* Fast
		+	* Ratiometric
		+	\|
		+	* TEV not tested in coils
		+	* Low output
		+
		+	\|}

Harriet D. Gliddon: /* C23O biobrick

Harriet D. Gliddon — Tue, 03 Aug 2010 16:29:39 GMT

/* C23O biobrick

←Older revision		Revision as of 16:29, 3 August 2010
Line 195:		Line 195:

	The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.		The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.
		+
		+	The C23O gene is already part of a BioBrick (Part:BBa_K118021).

	==James- some suggested papers:==		==James- some suggested papers:==

Harriet D. Gliddon: N- or C- terminus of C23O

Harriet D. Gliddon — Tue, 03 Aug 2010 15:55:08 GMT

N- or C- terminus of C23O

←Older revision		Revision as of 15:55, 3 August 2010
Line 191:		Line 191:
	We would make a fusion protein by adding, for example, GST to either the C- or N- terminus. This would hopefully prevent oligomerisation until the TEV protease is activated. TEV would specifically cleave the linker between GST and C23O, resulting in C23O monomers that are capable of oligomerising. Homotetramers would then be active and could catalyse the chromogenic reaction.		We would make a fusion protein by adding, for example, GST to either the C- or N- terminus. This would hopefully prevent oligomerisation until the TEV protease is activated. TEV would specifically cleave the linker between GST and C23O, resulting in C23O monomers that are capable of oligomerising. Homotetramers would then be active and could catalyse the chromogenic reaction.

		+	The N-terminus could be favoured because it seems to be more accessible to the protease as it is on the surface of the monomer.
		+	However, it is further away from the oligomerisation interfaces and so might not actually prevent oligomerisation.
		+
		+	The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.

	==James- some suggested papers:==		==James- some suggested papers:==

Harriet D. Gliddon: C23O

Harriet D. Gliddon — Tue, 03 Aug 2010 15:49:25 GMT

C23O

←Older revision		Revision as of 15:49, 3 August 2010
Line 181:		Line 181:
	Nucleotide:		Nucleotide:
	ggccgcagcctgtttaaaggcccgcgcgattataacccgattagcagcaccatttgccatctgaccaacgaaagcgatggccataccaccagcctgtatggcattggctttggcccgtttattattaccaacaaacatctgtttcgccgcaacaacggcaccctgctggtgcagagcctgcatggcgtgtttaaagtgaaaaacaccaccaccctgcagcagcatctgattgatggccgcgatatgattattattcgcatgccgaaagattttccgccgtttccgcagaaactgaaatttcgcgaaccgcagcgcgaagaacgcatttgcctggtgaccaccaactttcagaccaaaagcatgagcagcatggtgagcgataccagctgcacctttccgagcagcgatggcattttttggaaacattggattcagaccaaagatggccagtgcggcagcccgctggtgagcacccgcgatggctttattgtgggcattcatagcgcgagcaactttaccaacaccaacaactattttaccagcgtgccgaaaaactttatggaactgctgaccaaccaggaagcgcagcagtgggtgagcggctggcgcctgaacgcggatagcgtgctgtggggcggccataaagtgtttatggataaaccggaagaaccgtttcagccggtgaaagaagcgacccagctgatgaac		ggccgcagcctgtttaaaggcccgcgcgattataacccgattagcagcaccatttgccatctgaccaacgaaagcgatggccataccaccagcctgtatggcattggctttggcccgtttattattaccaacaaacatctgtttcgccgcaacaacggcaccctgctggtgcagagcctgcatggcgtgtttaaagtgaaaaacaccaccaccctgcagcagcatctgattgatggccgcgatatgattattattcgcatgccgaaagattttccgccgtttccgcagaaactgaaatttcgcgaaccgcagcgcgaagaacgcatttgcctggtgaccaccaactttcagaccaaaagcatgagcagcatggtgagcgataccagctgcacctttccgagcagcgatggcattttttggaaacattggattcagaccaaagatggccagtgcggcagcccgctggtgagcacccgcgatggctttattgtgggcattcatagcgcgagcaactttaccaacaccaacaactattttaccagcgtgccgaaaaactttatggaactgctgaccaaccaggaagcgcagcagtgggtgagcggctggcgcctgaacgcggatagcgtgctgtggggcggccataaagtgtttatggataaaccggaagaaccgtttcagccggtgaaagaagcgacccagctgatgaac
		+
		+	==C23O==
		+	Catechol 2,3-dioxygenase (also known as C23O or MPC) catalyses the conversion of a colourless substrate (catechol or substituted catechols) into a bright yellow product (2-hydroxymuconic semialdehyde) within seconds of substrate addition.
		+
		+	C23O is a homotetramer and its crystal structure has been solved. See [[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6VSR-4CXCWS0-8&_user=217827&_coverDate=01%2F15%2F1999&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=da4c70ba15ab6920ba7b6ec6cebb34cf Kita et al]] or use the accession code 1mpy.
		+
		+	C23O has also been expressed successfully in B. subtilis by [[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC393536/?tool=pubmed Zukowski et al]].
		+
		+	We would make a fusion protein by adding, for example, GST to either the C- or N- terminus. This would hopefully prevent oligomerisation until the TEV protease is activated. TEV would specifically cleave the linker between GST and C23O, resulting in C23O monomers that are capable of oligomerising. Homotetramers would then be active and could catalyse the chromogenic reaction.
		+

	==James- some suggested papers:==		==James- some suggested papers:==

Kirill Shkura: Luciferase reverse translate

Kirill Shkura — Mon, 02 Aug 2010 11:13:50 GMT

Luciferase reverse translate

←Older revision		Revision as of 11:13, 2 August 2010
Line 125:		Line 125:

	N-FLUC		N-FLUC
		+	protein
	daknikkgpapfypledgtageqlhkamkryalvpgtiaftdahievnityaeyfemsvrlaeamkryglntnhrivvcsenslqffmpvlgalfigvavapandiynerellnsmnisqptvvfvskkglqkilnvqkklpiiqkiiimdsktdyqgfqsmytfvtshlppgfneydfvpesfdrdktialimnssgstglpkgvalphrtacvrfshardpifgnqiipdtailsvvpfhhgfgmfttlgylicgfrvvlmyrfeeelflrslqdykiqsallvptlfsffakstlidkydlsnlheiasggaplskevgeavakrfhlpgirqgygltettsailitpegddkpgavgkvvpffeakvvdldtgktlgvnqrgelcvrgpmimsgyvnnpeatnalidkdg		daknikkgpapfypledgtageqlhkamkryalvpgtiaftdahievnityaeyfemsvrlaeamkryglntnhrivvcsenslqffmpvlgalfigvavapandiynerellnsmnisqptvvfvskkglqkilnvqkklpiiqkiiimdsktdyqgfqsmytfvtshlppgfneydfvpesfdrdktialimnssgstglpkgvalphrtacvrfshardpifgnqiipdtailsvvpfhhgfgmfttlgylicgfrvvlmyrfeeelflrslqdykiqsallvptlfsffakstlidkydlsnlheiasggaplskevgeavakrfhlpgirqgygltettsailitpegddkpgavgkvvpffeakvvdldtgktlgvnqrgelcvrgpmimsgyvnnpeatnalidkdg
		+
		+	Nucleotide
		+	gatgcgaaaaacattaaaaaaggcccggcgccgttttatccgctggaagatggcaccgcgggcgaacagctgcataaagcgatgaaacgctatgcgctggtgccgggcaccattgcgtttaccgatgcgcatattgaagtgaacattacctatgcggaatattttgaaatgagcgtgcgcctggcggaagcgatgaaacgctatggcctgaacaccaaccatcgcattgtggtgtgcagcgaaaacagcctgcagttttttatgccggtgctgggcgcgctgtttattggcgtggcggtggcgccggcgaacgatatttataacgaacgcgaactgctgaacagcatgaacattagccagccgaccgtggtgtttgtgagcaaaaaaggcctgcagaaaattctgaacgtgcagaaaaaactgccgattattcagaaaattattattatggatagcaaaaccgattatcagggctttcagagcatgtatacctttgtgaccagccatctgccgccgggctttaacgaatatgattttgtgccggaaagctttgatcgcgataaaaccattgcgctgattatgaacagcagcggcagcaccggcctgccgaaaggcgtggcgctgccgcatcgcaccgcgtgcgtgcgctttagccatgcgcgcgatccgatttttggcaaccagattattccggataccgcgattctgagcgtggtgccgtttcatcatggctttggcatgtttaccaccctgggctatctgatttgcggctttcgcgtggtgctgatgtatcgctttgaagaagaactgtttctgcgcagcctgcaggattataaaattcagagcgcgctgctggtgccgaccctgtttagcttttttgcgaaaagcaccctgattgataaatatgatctgagcaacctgcatgaaattgcgagcggcggcgcgccgctgagcaaagaagtgggcgaagcggtggcgaaacgctttcatctgccgggcattcgccagggctatggcctgaccgaaaccaccagcgcgattctgattaccccggaaggcgatgataaaccgggcgcggtgggcaaagtggtgccgttttttgaagcgaaagtggtggatctggataccggcaaaaccctgggcgtgaaccagcgcggcgaactgtgcgtgcgcggcccgatgattatgagcggctatgtgaacaacccggaagcgaccaacgcgctgattgataaagatggc
		+


	C-FLUC		C-FLUC
		+	Protein
	msgyvnnpeatnalidkdgwlhsgdiaywdedehffivdrlkslikykgyqvapaelesillqhpnifdagvaglpdddagelpaavvvlehgktmtekeivdyvasqvttakklrggvvfvdevpkgltgkldarkireilikakkggkskl		msgyvnnpeatnalidkdgwlhsgdiaywdedehffivdrlkslikykgyqvapaelesillqhpnifdagvaglpdddagelpaavvvlehgktmtekeivdyvasqvttakklrggvvfvdevpkgltgkldarkireilikakkggkskl
		+
		+	Nucleotide
		+	atgagcggctatgtgaacaacccggaagcgaccaacgcgctgattgataaagatggctggctgcatagcggcgatattgcgtattgggatgaagatgaacatttttttattgtggatcgcctgaaaagcctgattaaatataaaggctatcaggtggcgccggcggaactggaaagcattctgctgcagcatccgaacatttttgatgcgggcgtggcgggcctgccggatgatgatgcgggcgaactgccggcggcggtggtggtgctggaacatggcaaaaccatgaccgaaaaagaaattgtggattatgtggcgagccaggtgaccaccgcgaaaaaactgcgcggcggcgtggtgtttgtggatgaagtgccgaaaggcctgaccggcaaactggatgcgcgcaaaattcgcgaaattctgattaaagcgaaaaaaggcggcaaaagcaaactg

Kirill Shkura at 09:26, 2 August 2010

Kirill Shkura — Mon, 02 Aug 2010 09:26:10 GMT

←Older revision		Revision as of 09:26, 2 August 2010
Line 114:		Line 114:
	GenBank: AAA29795.1		GenBank: AAA29795.1

-	medaknikkgpapfypledgtageqlhkamkryalvpgtiaftdahievnityaeyfemsvrlaeamkryglntnhrivvcsenslqffmpvlgalfigvavapandiynerellnsmnisqptvvfvskkglqkilnvqkklpiiqkiiimdsktdyqgfqsmytfvtshlppgfneydfvpesfdrdktialimnssgstglpkgvalphrtacvrfshardpifgnqiipdtailsvvpfhhgfgmfttlgylicgfrvvlmyrfeeelflrslqdykiqsallvptlfsffakstlidkydlsnlheiasggaplskevgeavakrfhlpgirqgygltettsailitpegddkpgavgkvvpffeakvvdldtgktlgvnqrgelcvrgpmimsgyvnnpeatnalidkdgwlhsgdiaywdedehffivdrlkslikykgyqvapaelesillqhpnifdagvaglpdddagelpaavvvlehgktmtekeivdyvasqvttakklrggvvfvdevpkgltgkldarkireilikakkggkskl	+	can be obtained from Promega as a reporter plasmid pGL3

		+	medaknikkgpapfypledgtageqlhkamkryalvpgtiaftdahievnityaeyfemsvrlaeamkryglntnhrivvcsenslqffmpvlgalfigvavapandiynerellnsmnisqptvvfvskkglqkilnvqkklpiiqkiiimdsktdyqgfqsmytfvtshlppgfneydfvpesfdrdktialimnssgstglpkgvalphrtacvrfshardpifgnqiipdtailsvvpfhhgfgmfttlgylicgfrvvlmyrfeeelflrslqdykiqsallvptlfsffakstlidkydlsnlheiasggaplskevgeavakrfhlpgirqgygltettsailitpegddkpgavgkvvpffeakvvdldtgktlgvnqrgelcvrgpmimsgyvnnpeatnalidkdgwlhsgdiaywdedehffivdrlkslikykgyqvapaelesillqhpnifdagvaglpdddagelpaavvvlehgktmtekeivdyvasqvttakklrggvvfvdevpkgltgkldarkireilikakkggkskl