IGEM:Imperial/2010/Output module

From OpenWetWare

< IGEM:Imperial/2010(Difference between revisions)
Jump to: navigation, search
(Our autoinhibitory coiled-coil output constructs)
Current revision (12:12, 23 September 2010) (view source)
(17 intermediate revisions not shown.)
Line 1: Line 1:
{| class="wikitable" style="text-align: center; width: 50%; height: 170px;" border="1"
{| class="wikitable" style="text-align: center; width: 50%; height: 170px;" border="1"
Line 59: Line 60:
Line 68: Line 69:
(GGGS)3 is the flexible linker between the split protease/enzyme and the coil!!
===Beta-Lactamase construct===  
===Beta-Lactamase construct===  
NβLac-A-TEV-B’4A βLactamase (26-196) TEV
NβLac-A-TEV-B’4A βLactamase (26-196)(Glu) TEV
B-CβLac βLactamase (198-290)
B-CβLac βLactamase (Leu)(198-290)
LacB from pQE32 plasmid [[http://www.nature.com/nbt/journal/v20/n6/full/nbt0602-619.html#f1]]
Showing sequences for the B-Lactamase, the sequences are split into the two halves with the gap in the middle.
Protein 286aa
fluorocilin green (Invitrogen) was used as the fluorescing substrate.
fluorocilin green (Invitrogen) was used as the fluorescing substrate.
===Split luciferase===
entire seq:
Luciferase [Photinus pyralis]
GenBank: AAA29795.1
can be obtained from Promega as a reporter plasmid pGL3
Firefly Luciferase(2-416)
Firefly Luciferase( 398-550)
===Superfolder split GFP===  
===Superfolder split GFP===  
Line 114: Line 174:
==Re-confirmed sequence for S219D TEV construct==
Catechol 2,3-dioxygenase (also known as C23O or MPC) catalyses the conversion of a colourless substrate (catechol or substituted catechols) into a bright yellow product (2-hydroxymuconic semialdehyde) within seconds of substrate addition.
C23O is a homotetramer and its crystal structure has been solved. See [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6VSR-4CXCWS0-8&_user=217827&_coverDate=01%2F15%2F1999&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=da4c70ba15ab6920ba7b6ec6cebb34cf Kita et al] or use the accession code 1mpy.
C23O has also been expressed successfully in B. subtilis by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC393536/?tool=pubmed Zukowski et al].
We would make a fusion protein by adding, for example, GST to either the C- or N- terminus. This would hopefully prevent oligomerisation until the TEV protease is activated. TEV would specifically cleave the linker between GST and C23O, resulting in C23O monomers that are capable of oligomerising. Homotetramers would then be active and could catalyse the chromogenic reaction.
The N-terminus could be favoured because it seems to be more accessible to the protease as it is on the surface of the monomer.
However, it is further away from the oligomerisation interfaces and so might not actually prevent oligomerisation.
The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.
However, when we looked at C23O in Pymol, we noticed that the N-termini were probably closer to the oligomerisation interfaces (see below). Also, we were also worried that we might still get dimerisation if we used the N-terminus for our fusion protein. However, [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6VSR-4CXCWS0-8&_user=217827&_coverDate=01%2F15%2F1999&_rdoc=1&_fmt=high&_orig=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=da4c70ba15ab6920ba7b6ec6cebb34cf Kita et al] show that the projecting loop is needed for dimerisation, and this is very near to the N-terminus.
[[Image:Tetramer of C23O.PNG]]
The C23O gene is already part of a BioBrick (Part:BBa_K118021).
==James- some suggested papers:==
==James- some suggested papers:==
Line 130: Line 219:
* [http://pubs.acs.org/doi/full/10.1021/ac010717k Protein Splicing-Based Reconstitution of Split Green Fluorescent Protein for Monitoring Protein−Protein Interactions in Bacteria: Improved Sensitivity and Reduced Screening Time]
* [http://pubs.acs.org/doi/full/10.1021/ac010717k Protein Splicing-Based Reconstitution of Split Green Fluorescent Protein for Monitoring Protein−Protein Interactions in Bacteria: Improved Sensitivity and Reduced Screening Time]
* [http://pubs.acs.org/doi/full/10.1021/ac000617z A Fluorescent Indicator for Detecting Protein−Protein Interactions in Vivo Based on Protein Splicing]
* [http://pubs.acs.org/doi/full/10.1021/ac000617z A Fluorescent Indicator for Detecting Protein−Protein Interactions in Vivo Based on Protein Splicing]
==Possible Outputs and their pros and cons==
{| class="wikitable" style="text-align: center; width: 50%; height: 170px;" border="1"
  ! Output !! Substrate !! Pros !!Cons
  | Split β-lactamase
* Flourocilin green
* Cheap
* β-lac tested and shown to work
* Ceph kills cells
* Visible colour output
* Lyses cells
* Quantification difficult
  | Split Luciferase
  | Luciferin
* Quantification
* Poor expression
* Expensive
* Lyses cells
  | Split TEV
* C230-dihydrogenase
* Fast
* Visible colour output (yellow)
* In registry
* Works in B.Sub
* Cheap substrate
* TEV not tested in coils
* Protein engineering
  | Split TEV
* FRET pair
* Fast
* Established
* TEV not tested in coils
* No visible colour - florescence
  | Split TEV
* Fast
* Ratiometric
* TEV not tested in coils
* Low output

Current revision

Effector 1 (Protease) Effector 2 (Dye,Enz) Pigment biosynthetic pathways
transcr sigma 54 2 colourless Bilins
Activation (phosphorylation) Enz-in-pathway
  • short pathways
  • ensure - colourless -> colour
  • short pathways
  • ensure - colourless -> colour
Target proteases to use
  • not many AA
  • non-toxic
  • can work in E.Coli
  • quantize speed, efficiency
Protein scaffold Fret pairs as back up for effectors
2C DNA binding prot release

This review article has some useful information on FRET.


Our autoinhibitory coiled-coil output constructs

Taken and adapted from the JACS article 'An Autoinhibited Coiled-Coil Design Strategy for Split-Protein Protease Sensors' ref

The construct design is of the order:

A’-TEV-B-NFluc Cfluc-A-TEV-B‘2A

Where in our case NFluc and CFluc will be NBlactamase CBlactamase//split eGFP and split TEV itself. The 2A refers to a mutated variation of the original coil sequence (AQLKKKLQANKKELAQLKWKLQALKKKLAQ)which produced a better coil activity.


gcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcag


gcgcaggcgaaaaaaaaagcgcaggcgaacaaaaaagaactggcgcagctgaaatggaaa ctgcaggcgctgaaaaaaaaactggcgcag

Tobacco etch virus (TEV) protease-cleavable linker (GGGGENLYFQGGKLGGGG)was used.

ggcggcggcggcgaaaacctgtattttcagggcggcaaactgggcggcggcggc LINKER

Overall sequence for Coiled-coil construct


ggcggcggcagcggcggcggcagcggcggcggcagcgcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcagggcggcggcggcgaaaacctgtattttcag ggcggcaaactgggcggcggcggcgcgcaggcgaaaaaaaaagcgcaggcgaacaaaaaa gaactggcgcagctgaaatggaaactgcaggcgctgaaaaaaaaactggcgcag


gcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcagggcggcggcggcgaaaacctgtattttcag ggcggcaaactgggcggcggcggcgcgcagctgaaaaaaaaactgcaggcgaacaaaaaa gaactggcgcagctgaaatggaaactgcaggcgctgaaaaaaaaactggcgcagggcggcggcagcggcggcggcagcggcggcggcagc

(GGGS)3 is the flexible linker between the split protease/enzyme and the coil!!

Beta-Lactamase construct

NβLac-A-TEV-B’4A βLactamase (26-196)(Glu) TEV B-CβLac βLactamase (Leu)(198-290)

LacB from pQE32 plasmid [[1]]

Showing sequences for the B-Lactamase, the sequences are split into the two halves with the gap in the middle.




Nucleotide atgagcattcagcattttcgcgtggcgctgattccgttttttgcggcgttttgcctgccggtgtttgcgcatccggaaaccctggtgaaagtgaaagatgcggaagatcagctgggcgcgcgcgtgggctatattgaactggatctgaacagcggcaaaattctggaaagctttcgcccggaagaacgctttccgatgatgagcacctttaaagtgctgctgtgcggcgcggtgctgagccgcattgatgcgggccaggaacagctgggccgccgcattcattatagccagaacgatctggtggaatatagcccggtgaccgaaaaacatctgaccgatggcatgaccgtgcgcgaactgtgcagcgcggcgattaccatgagcgataacaccgcggcgaacctgctgctgaccaccattggcggcccgaaagaactgaccgcgtttctgcataacatgggcgatcatgtgacccgcctggatcgctgggaaccggaactgaacgaagcgattccgaacgatgaacgcgataccaccatgccggtggcgatggcgaccaccctgcgcaaactgctgaccggc



fluorocilin green (Invitrogen) was used as the fluorescing substrate.

Split luciferase

entire seq:

Luciferase [Photinus pyralis] GenBank: AAA29795.1

can be obtained from Promega as a reporter plasmid pGL3


Firefly Luciferase(2-416) Firefly Luciferase( 398-550)

N-FLUC protein daknikkgpapfypledgtageqlhkamkryalvpgtiaftdahievnityaeyfemsvrlaeamkryglntnhrivvcsenslqffmpvlgalfigvavapandiynerellnsmnisqptvvfvskkglqkilnvqkklpiiqkiiimdsktdyqgfqsmytfvtshlppgfneydfvpesfdrdktialimnssgstglpkgvalphrtacvrfshardpifgnqiipdtailsvvpfhhgfgmfttlgylicgfrvvlmyrfeeelflrslqdykiqsallvptlfsffakstlidkydlsnlheiasggaplskevgeavakrfhlpgirqgygltettsailitpegddkpgavgkvvpffeakvvdldtgktlgvnqrgelcvrgpmimsgyvnnpeatnalidkdg

Nucleotide gatgcgaaaaacattaaaaaaggcccggcgccgttttatccgctggaagatggcaccgcgggcgaacagctgcataaagcgatgaaacgctatgcgctggtgccgggcaccattgcgtttaccgatgcgcatattgaagtgaacattacctatgcggaatattttgaaatgagcgtgcgcctggcggaagcgatgaaacgctatggcctgaacaccaaccatcgcattgtggtgtgcagcgaaaacagcctgcagttttttatgccggtgctgggcgcgctgtttattggcgtggcggtggcgccggcgaacgatatttataacgaacgcgaactgctgaacagcatgaacattagccagccgaccgtggtgtttgtgagcaaaaaaggcctgcagaaaattctgaacgtgcagaaaaaactgccgattattcagaaaattattattatggatagcaaaaccgattatcagggctttcagagcatgtatacctttgtgaccagccatctgccgccgggctttaacgaatatgattttgtgccggaaagctttgatcgcgataaaaccattgcgctgattatgaacagcagcggcagcaccggcctgccgaaaggcgtggcgctgccgcatcgcaccgcgtgcgtgcgctttagccatgcgcgcgatccgatttttggcaaccagattattccggataccgcgattctgagcgtggtgccgtttcatcatggctttggcatgtttaccaccctgggctatctgatttgcggctttcgcgtggtgctgatgtatcgctttgaagaagaactgtttctgcgcagcctgcaggattataaaattcagagcgcgctgctggtgccgaccctgtttagcttttttgcgaaaagcaccctgattgataaatatgatctgagcaacctgcatgaaattgcgagcggcggcgcgccgctgagcaaagaagtgggcgaagcggtggcgaaacgctttcatctgccgggcattcgccagggctatggcctgaccgaaaccaccagcgcgattctgattaccccggaaggcgatgataaaccgggcgcggtgggcaaagtggtgccgttttttgaagcgaaagtggtggatctggataccggcaaaaccctgggcgtgaaccagcgcggcgaactgtgcgtgcgcggcccgatgattatgagcggctatgtgaacaacccggaagcgaccaacgcgctgattgataaagatggc

C-FLUC Protein msgyvnnpeatnalidkdgwlhsgdiaywdedehffivdrlkslikykgyqvapaelesillqhpnifdagvaglpdddagelpaavvvlehgktmtekeivdyvasqvttakklrggvvfvdevpkgltgkldarkireilikakkggkskl

Nucleotide atgagcggctatgtgaacaacccggaagcgaccaacgcgctgattgataaagatggctggctgcatagcggcgatattgcgtattgggatgaagatgaacatttttttattgtggatcgcctgaaaagcctgattaaatataaaggctatcaggtggcgccggcggaactggaaagcattctgctgcagcatccgaacatttttgatgcgggcgtggcgggcctgccggatgatgatgcgggcgaactgccggcggcggtggtggtgctggaacatggcaaaaccatgaccgaaaaagaaattgtggattatgtggcgagccaggtgaccaccgcgaaaaaactgcgcggcggcgtggtgtttgtggatgaagtgccgaaaggcctgaccggcaaactggatgcgcgcaaaattcgcgaaattctgattaaagcgaaaaaaggcggcaaaagcaaactg

Superfolder split GFP

NOTE readily self assembles as does split Beta-galactosidase

'One fragment of the split GFP contains the first 214 residues of the exceptionally stable, fast-folding ‘‘superfolder’’ GFP protein (Pedelacq et al., 2006), further evolved to be stable as a protein fragment. This fragment includes ten of the eleven strands of the beta-barrel structure of GFP and will be called spGFP1-10. The second split-GFP fragment consists of just 16 residues, 215– 230, which make up the 11th strand of the GFP b-barrel. This second fragment, spGFP11, acts as a small protein tag that can be inserted into many different proteins without affecting their solubility' ref

Amino acid and sequence of the GFP 11 cassette:






Re-confirmed sequence for S219D TEV construct


Nucleotide: ggccgcagcctgtttaaaggcccgcgcgattataacccgattagcagcaccatttgccatctgaccaacgaaagcgatggccataccaccagcctgtatggcattggctttggcccgtttattattaccaacaaacatctgtttcgccgcaacaacggcaccctgctggtgcagagcctgcatggcgtgtttaaagtgaaaaacaccaccaccctgcagcagcatctgattgatggccgcgatatgattattattcgcatgccgaaagattttccgccgtttccgcagaaactgaaatttcgcgaaccgcagcgcgaagaacgcatttgcctggtgaccaccaactttcagaccaaaagcatgagcagcatggtgagcgataccagctgcacctttccgagcagcgatggcattttttggaaacattggattcagaccaaagatggccagtgcggcagcccgctggtgagcacccgcgatggctttattgtgggcattcatagcgcgagcaactttaccaacaccaacaactattttaccagcgtgccgaaaaactttatggaactgctgaccaaccaggaagcgcagcagtgggtgagcggctggcgcctgaacgcggatagcgtgctgtggggcggccataaagtgtttatggataaaccggaagaaccgtttcagccggtgaaagaagcgacccagctgatgaac


Catechol 2,3-dioxygenase (also known as C23O or MPC) catalyses the conversion of a colourless substrate (catechol or substituted catechols) into a bright yellow product (2-hydroxymuconic semialdehyde) within seconds of substrate addition.

C23O is a homotetramer and its crystal structure has been solved. See Kita et al or use the accession code 1mpy.

C23O has also been expressed successfully in B. subtilis by Zukowski et al.

We would make a fusion protein by adding, for example, GST to either the C- or N- terminus. This would hopefully prevent oligomerisation until the TEV protease is activated. TEV would specifically cleave the linker between GST and C23O, resulting in C23O monomers that are capable of oligomerising. Homotetramers would then be active and could catalyse the chromogenic reaction.

The N-terminus could be favoured because it seems to be more accessible to the protease as it is on the surface of the monomer. However, it is further away from the oligomerisation interfaces and so might not actually prevent oligomerisation.

The C-terminus, on the other hand, is less accessible, but fusing GST there could prevent entry of the substrate into the funnel that runs through the enzyme. It is also closer to the oligomerisation domain and so fusing GST here is more likely to prevent oligomerisation.

However, when we looked at C23O in Pymol, we noticed that the N-termini were probably closer to the oligomerisation interfaces (see below). Also, we were also worried that we might still get dimerisation if we used the N-terminus for our fusion protein. However, Kita et al show that the projecting loop is needed for dimerisation, and this is very near to the N-terminus.

Image:Tetramer of C23O.PNG

The C23O gene is already part of a BioBrick (Part:BBa_K118021).

James- some suggested papers:

  1. Kerppola TK. . pmid:17117150. PubMed HubMed [1]
  2. Wehr MC, Laage R, Bolz U, Fischer TM, Grünewald S, Scheek S, Bach A, Nave KA, and Rossner MJ. . pmid:17072307. PubMed HubMed [2]
All Medline abstracts: PubMed HubMed

GFP as output


Possible Outputs and their pros and cons

Output Substrate Pros Cons
Split β-lactamase
  • Cephalosporin
  • Flourocilin green
  • Cheap
  • β-lac tested and shown to work
  • Ceph kills cells
  • Visible colour output
  • Lyses cells
  • Quantification difficult
Split Luciferase Luciferin
  • Quantification
  • Poor expression
  • Expensive
  • Lyses cells
Split TEV
  • C230-dihydrogenase
  • Fast
  • Visible colour output (yellow)
  • In registry
  • Works in B.Sub
  • Cheap substrate
  • TEV not tested in coils
  • Protein engineering
Split TEV
  • FRET pair
  • Fast
  • Established
  • TEV not tested in coils
  • No visible colour - florescence
Split TEV
  • EGFP
  • Fast
  • Ratiometric
  • TEV not tested in coils
  • Low output
Personal tools