IGEM:Imperial/2010/Output module

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Our autoinhibitory coiled-coil output constructs)
(Our autoinhibitory coiled-coil output constructs)
Line 56: Line 56:
ggcggcggcggcgaaaacctgtattttcagggcggcaaactgggcggcggcggc  LINKER
ggcggcggcggcgaaaacctgtattttcagggcggcaaactgggcggcggcggc  LINKER
===Beta-Lactamase construct=== NβLac-A-TEV-B’4A βLactamase (26-196) TEV
===Beta-Lactamase construct===  
NβLac-A-TEV-B’4A βLactamase (26-196) TEV
B-CβLac βLactamase (198-290)
B-CβLac βLactamase (198-290)

Revision as of 05:55, 29 July 2010

Effector 1 (Protease) Effector 2 (Dye,Enz) Pigment biosynthetic pathways
transcr sigma 54 2 colourless Bilins
Activation (phosphorylation) Enz-in-pathway
  • short pathways
  • ensure - colourless -> colour
  • short pathways
  • ensure - colourless -> colour
Target proteases to use
  • not many AA
  • non-toxic
  • can work in E.Coli
  • quantize speed, efficiency
Protein scaffold Fret pairs as back up for effectors
2C DNA binding prot release

This review article has some useful information on FRET.


Our autoinhibitory coiled-coil output constructs

Taken and adapted from the JACS article 'An Autoinhibited Coiled-Coil Design Strategy for Split-Protein Protease Sensors' ref

The construct design is of the order:

A’-TEV-B-NFluc Cfluc-A-TEV-B‘2A

Where in our case NFluc and CFluc will be NBlactamase CBlactamase//split eGFP and split TEV itself. The 2A refers to a mutated variation of the original coil sequence (AQLKKKLQANKKELAQLKWKLQALKKKLAQ)which produced a better coil activity.


gcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcag


gcgcaggcgaaaaaaaaagcgcaggcgaacaaaaaagaactggcgcagctgaaatggaaa ctgcaggcgctgaaaaaaaaactggcgcag

Tobacco etch virus (TEV) protease-cleavable linker (GGGGENLYFQGGKLGGGG)was used.

ggcggcggcggcgaaaacctgtattttcagggcggcaaactgggcggcggcggc LINKER

Beta-Lactamase construct

NβLac-A-TEV-B’4A βLactamase (26-196) TEV B-CβLac βLactamase (198-290)

James- some suggested papers:

  1. Kerppola TK. . pmid:17117150. PubMed HubMed [1]
  2. Wehr MC, Laage R, Bolz U, Fischer TM, Grünewald S, Scheek S, Bach A, Nave KA, and Rossner MJ. . pmid:17072307. PubMed HubMed [2]
All Medline abstracts: PubMed HubMed

GFP as output


Personal tools