IGEM:Imperial/2010/Output module: Difference between revisions
Line 56: | Line 56: | ||
ggcggcggcggcgaaaacctgtattttcagggcggcaaactgggcggcggcggc LINKER | ggcggcggcggcgaaaacctgtattttcagggcggcaaactgggcggcggcggc LINKER | ||
===Beta-Lactamase construct=== NβLac-A-TEV-B’4A βLactamase (26-196) TEV | |||
B-CβLac βLactamase (198-290) | |||
==James- some suggested papers:== | ==James- some suggested papers:== |
Revision as of 02:54, 29 July 2010
Effector 1 (Protease) | Effector 2 (Dye,Enz) | Pigment biosynthetic pathways |
---|---|---|
transcr sigma 54 | 2 colourless | Bilins |
Activation (phosphorylation) | Enz-in-pathway
|
Anthocyanins
|
Target proteases to use
|
Protein scaffold | Fret pairs as back up for effectors |
2C DNA binding prot release |
This review article has some useful information on FRET.
Our autoinhibitory coiled-coil output constructs
Taken and adapted from the JACS article 'An Autoinhibited Coiled-Coil Design Strategy for Split-Protein Protease Sensors' ref
The construct design is of the order:
A’-TEV-B-NFluc Cfluc-A-TEV-B‘2A
Where in our case NFluc and CFluc will be NBlactamase CBlactamase//split eGFP and split TEV itself. The 2A refers to a mutated variation of the original coil sequence (AQLKKKLQANKKELAQLKWKLQALKKKLAQ)which produced a better coil activity.
AQLEKELQALEKKLAQLEWENQALEKELAQ (A')
gcgcagctggaaaaagaactgcaggcgctggaaaaaaaactggcgcagctggaatgggaa aaccaggcgctggaaaaagaactggcgcag
AQAKKKAQANKKELAQLKWKLQALKKKLAQ (B'2A)
gcgcaggcgaaaaaaaaagcgcaggcgaacaaaaaagaactggcgcagctgaaatggaaa ctgcaggcgctgaaaaaaaaactggcgcag
Tobacco etch virus (TEV) protease-cleavable linker (GGGGENLYFQGGKLGGGG)was used.
ggcggcggcggcgaaaacctgtattttcagggcggcaaactgggcggcggcggc LINKER
===Beta-Lactamase construct=== NβLac-A-TEV-B’4A βLactamase (26-196) TEV B-CβLac βLactamase (198-290)
James- some suggested papers:
- Kerppola TK. Complementary methods for studies of protein interactions in living cells. Nat Methods. 2006 Dec;3(12):969-71. DOI:10.1038/nmeth1206-969 |
- Wehr MC, Laage R, Bolz U, Fischer TM, Grünewald S, Scheek S, Bach A, Nave KA, and Rossner MJ. Monitoring regulated protein-protein interactions using split TEV. Nat Methods. 2006 Dec;3(12):985-93. DOI:10.1038/nmeth967 |
GFP as output
- In vivo and in vitro protein solubility assays using split GFP
- Monitoring of conformational change in maltose binding protein using split green fluorescent protein
- Protein Splicing-Based Reconstitution of Split Green Fluorescent Protein for Monitoring Protein−Protein Interactions in Bacteria: Improved Sensitivity and Reduced Screening Time
- A Fluorescent Indicator for Detecting Protein−Protein Interactions in Vivo Based on Protein Splicing