IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/28: Difference between revisions
Line 6: | Line 6: | ||
| colspan="2"| | | colspan="2"| | ||
==Team Allergy== | ==Team Allergy== | ||
===Protocol=== | |||
Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation. | Yesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation. | ||
Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. | Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. We will also do ligations with the false negatives (Sense + PDK ligate with Antisense). | ||
#Culture colonies | |||
#Miniprep | |||
#Nanodrop | |||
#Digest false negatives | |||
#Ligate | |||
#Transform | |||
===Results=== | |||
'''Nanodrop''' | |||
The format is: Miniprep # , Name of Allergen, concentration in ng/μL of colony 1, concentration in ng/μL of colony 2. | |||
All these working ligations are with the PAL intron | |||
#9, LTP, 97.9, 94.1 | |||
#11, LTP, 77.9, 94.8 | |||
#25, Bet v2, 67.8, 97.8 (there was a mixup with colony 1 and LTP+PDK, but it is now fixed in our electronic notebooks) | |||
#28, Bet v2, 73.2, 83.6 | |||
#36, Ger3, 76.1, 83.4 | |||
#37, Ger3, 70.0, 75.3 | |||
#38, Ger3, 90.4, 108.3 | |||
*Transformed more sense+pdk parts for our false negatives (16,30,31) | *Transformed more sense+pdk parts for our false negatives (16,30,31) |
Revision as of 12:02, 30 July 2010
iGEM iGarden | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Team AllergyProtocolYesterday, we plated E. coli containing complete hpRNA for Ger, Bet v2, and LTP. Bet v1 did not ligate properly in the earlier Sense+Intron ligation. Today, we will extract the plasmids from the E. coli and prepare them for sequencing tomorrow. We will also do ligations with the false negatives (Sense + PDK ligate with Antisense).
ResultsNanodrop The format is: Miniprep # , Name of Allergen, concentration in ng/μL of colony 1, concentration in ng/μL of colony 2. All these working ligations are with the PAL intron
Team FlavorPCR Confirmation
The numerical differentiation refers to the specific genomic DNA sample PCR of Wintergreen parts
Primers: J45004_F Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3' J45004_R Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum) J45017_F Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3' J45017_R Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3' The PCR reaction was set-up as per the specifications from the Phusion Polymerase manual (http://www.neb.com/nebecomm/ManualFiles/manualF-530.pdf). For template DNA, 3.5 ng of the J45700 BioBrick part (the entire wintergreen pathway) was used.
Team FenceMiniprepsBarnase Digest Gel Extraction |