IGEM:Harvard/2007/Two Component Systems

From OpenWetWare
Jump to navigationJump to search

FecA Two Component System

Planned Work

Completed Work

Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’

Brainstorming

Initial Plan (6/25/07)

Readings

  1. Koebnik R, Locher KP, and Van Gelder P. Structure and function of bacterial outer membrane proteins: barrels in a nutshell. Mol Microbiol. 2000 Jul;37(2):239-53. DOI:10.1046/j.1365-2958.2000.01983.x | PubMed ID:10931321 | HubMed [FecAPorins1]
  2. Vica Pacheco S, García González O, and Paniagua Contreras GL. The lom gene of bacteriophage lambda is involved in Escherichia coli K12 adhesion to human buccal epithelial cells. FEMS Microbiol Lett. 1997 Nov 1;156(1):129-32. DOI:10.1111/j.1574-6968.1997.tb12717.x | PubMed ID:9368371 | HubMed [FecAPorins2]
  3. Wimley WC. The versatile beta-barrel membrane protein. Curr Opin Struct Biol. 2003 Aug;13(4):404-11. DOI:10.1016/s0959-440x(03)00099-x | PubMed ID:12948769 | HubMed [FecAPorins3]
  4. Braun V, Mahren S, and Sauter A. Gene regulation by transmembrane signaling. Biometals. 2006 Apr;19(2):103-13. DOI:10.1007/s10534-005-8253-y | PubMed ID:16718597 | HubMed [FecAPorins4]
  5. Ferguson AD, Amezcua CA, Halabi NM, Chelliah Y, Rosen MK, Ranganathan R, and Deisenhofer J. Signal transduction pathway of TonB-dependent transporters. Proc Natl Acad Sci U S A. 2007 Jan 9;104(2):513-8. DOI:10.1073/pnas.0609887104 | PubMed ID:17197416 | HubMed [FecAPorins5]
  6. Braun V, Mahren S, and Sauter A. Gene regulation by transmembrane signaling. Biometals. 2006 Apr;19(2):103-13. DOI:10.1007/s10534-005-8253-y | PubMed ID:16718597 | HubMed [FecAPorins6]
  7. Ferguson AD, Chakraborty R, Smith BS, Esser L, van der Helm D, and Deisenhofer J. Structural basis of gating by the outer membrane transporter FecA. Science. 2002 Mar 1;295(5560):1715-9. DOI:10.1126/science.1067313 | PubMed ID:11872840 | HubMed [FecAPorins7]
  8. Sauter A and Braun V. Defined inactive FecA derivatives mutated in functional domains of the outer membrane transport and signaling protein of Escherichia coli K-12. J Bacteriol. 2004 Aug;186(16):5303-10. DOI:10.1128/JB.186.16.5303-5310.2004 | PubMed ID:15292131 | HubMed [FecAPorins8]
  9. Yue WW, Grizot S, and Buchanan SK. Structural evidence for iron-free citrate and ferric citrate binding to the TonB-dependent outer membrane transporter FecA. J Mol Biol. 2003 Sep 12;332(2):353-68. DOI:10.1016/s0022-2836(03)00855-6 | PubMed ID:12948487 | HubMed [FecAPorins9]
  10. Garcia-Herrero A and Vogel HJ. Nuclear magnetic resonance solution structure of the periplasmic signalling domain of the TonB-dependent outer membrane transporter FecA from Escherichia coli. Mol Microbiol. 2005 Dec;58(5):1226-37. DOI:10.1111/j.1365-2958.2005.04889.x | PubMed ID:16313612 | HubMed [FecAPorins10]
  11. Breidenstein E, Mahren S, and Braun V. Residues involved in FecR binding are localized on one side of the FecA signaling domain in Escherichia coli. J Bacteriol. 2006 Sep;188(17):6440-2. DOI:10.1128/JB.00741-06 | PubMed ID:16923915 | HubMed [FecAPorins11]
  12. Russ WP, Lowery DM, Mishra P, Yaffe MB, and Ranganathan R. Natural-like function in artificial WW domains. Nature. 2005 Sep 22;437(7058):579-83. DOI:10.1038/nature03990 | PubMed ID:16177795 | HubMed [FecAPorins12]

All Medline abstracts: PubMed | HubMed