IGEM:Harvard/2007/Two Component Systems: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
m (→Completed Work) |
m (→Completed Work) |
||
Line 4: | Line 4: | ||
== Completed Work == | == Completed Work == | ||
Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system. | 6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system. | ||
The oligos ordered were as follows: | The oligos ordered were as follows: | ||
Line 13: | Line 13: | ||
5’- | 5’- | ||
GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’ | GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’ | ||
6/27/07 - Miniprepped bacteria (FecA, FecI, FecR) to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x. | |||
== Brainstorming == | == Brainstorming == |
Revision as of 14:02, 27 June 2007
FecA Two Component System
Planned Work
Completed Work
6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.
The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’
Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’
6/27/07 - Miniprepped bacteria (FecA, FecI, FecR) to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.
Brainstorming
Initial Plan (6/25/07)
Readings
- Koebnik R, Locher KP, and Van Gelder P. Structure and function of bacterial outer membrane proteins: barrels in a nutshell. Mol Microbiol. 2000 Jul;37(2):239-53. DOI:10.1046/j.1365-2958.2000.01983.x |
- Vica Pacheco S, García González O, and Paniagua Contreras GL. The lom gene of bacteriophage lambda is involved in Escherichia coli K12 adhesion to human buccal epithelial cells. FEMS Microbiol Lett. 1997 Nov 1;156(1):129-32. DOI:10.1111/j.1574-6968.1997.tb12717.x |
- Wimley WC. The versatile beta-barrel membrane protein. Curr Opin Struct Biol. 2003 Aug;13(4):404-11. DOI:10.1016/s0959-440x(03)00099-x |
- Braun V, Mahren S, and Sauter A. Gene regulation by transmembrane signaling. Biometals. 2006 Apr;19(2):103-13. DOI:10.1007/s10534-005-8253-y |
- Ferguson AD, Amezcua CA, Halabi NM, Chelliah Y, Rosen MK, Ranganathan R, and Deisenhofer J. Signal transduction pathway of TonB-dependent transporters. Proc Natl Acad Sci U S A. 2007 Jan 9;104(2):513-8. DOI:10.1073/pnas.0609887104 |
- Braun V, Mahren S, and Sauter A. Gene regulation by transmembrane signaling. Biometals. 2006 Apr;19(2):103-13. DOI:10.1007/s10534-005-8253-y |
- Ferguson AD, Chakraborty R, Smith BS, Esser L, van der Helm D, and Deisenhofer J. Structural basis of gating by the outer membrane transporter FecA. Science. 2002 Mar 1;295(5560):1715-9. DOI:10.1126/science.1067313 |
- Sauter A and Braun V. Defined inactive FecA derivatives mutated in functional domains of the outer membrane transport and signaling protein of Escherichia coli K-12. J Bacteriol. 2004 Aug;186(16):5303-10. DOI:10.1128/JB.186.16.5303-5310.2004 |
- Yue WW, Grizot S, and Buchanan SK. Structural evidence for iron-free citrate and ferric citrate binding to the TonB-dependent outer membrane transporter FecA. J Mol Biol. 2003 Sep 12;332(2):353-68. DOI:10.1016/s0022-2836(03)00855-6 |
- Garcia-Herrero A and Vogel HJ. Nuclear magnetic resonance solution structure of the periplasmic signalling domain of the TonB-dependent outer membrane transporter FecA from Escherichia coli. Mol Microbiol. 2005 Dec;58(5):1226-37. DOI:10.1111/j.1365-2958.2005.04889.x |
- Breidenstein E, Mahren S, and Braun V. Residues involved in FecR binding are localized on one side of the FecA signaling domain in Escherichia coli. J Bacteriol. 2006 Sep;188(17):6440-2. DOI:10.1128/JB.00741-06 |
- Russ WP, Lowery DM, Mishra P, Yaffe MB, and Ranganathan R. Natural-like function in artificial WW domains. Nature. 2005 Sep 22;437(7058):579-83. DOI:10.1038/nature03990 |