IGEM:Harvard/2007/Laboratory Notebooks/Two Component System: Difference between revisions
No edit summary |
mNo edit summary |
||
| Line 1: | Line 1: | ||
6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system. | 6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system. | ||
The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’ | The oligos ordered were as follows: | ||
Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’ | |||
Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’ | Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’ | ||
| Line 13: | Line 15: | ||
SV001 - FecA plus VF2 | SV001 - FecA plus VF2 | ||
SV002 - FecA plus VR | SV002 - FecA plus VR | ||
SV003 - FecR plus VF2 | SV003 - FecR plus VF2 | ||
SV004 - FecR plus VR | SV004 - FecR plus VR | ||
SV005 - FecI plus VF2 | SV005 - FecI plus VF2 | ||
SV006 - FecI plus VR | SV006 - FecI plus VR | ||
Insert site directed mutagenesis stuff here | Insert site directed mutagenesis stuff here | ||
| Line 23: | Line 31: | ||
7/9/07<br> | 7/9/07<br> | ||
-miniprep of site directed mutagenesis using QiaGen Miniprep kit | -miniprep of site directed mutagenesis using QiaGen Miniprep kit | ||
-purification of construct C1+C2 extension rxn R1 using QiaGen PCR purification protocol--labeled product 'FecA promoter biobrick' | -purification of construct C1+C2 extension rxn R1 using QiaGen PCR purification protocol--labeled product 'FecA promoter biobrick' | ||
-received E Coli AA93, plasmid pLCIRA, pGFPA' from Germany, waiting on instructions from Dr. Braun on how to plate them. | -received E Coli AA93, plasmid pLCIRA, pGFPA' from Germany, waiting on instructions from Dr. Braun on how to plate them. | ||
-grow E0240 in liquid culture | -grow E0240 in liquid culture | ||
Revision as of 14:04, 9 July 2007
6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.
The oligos ordered were as follows:
Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’
Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’
6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.
[edit]
6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:
SV001 - FecA plus VF2
SV002 - FecA plus VR
SV003 - FecR plus VF2
SV004 - FecR plus VR
SV005 - FecI plus VF2
SV006 - FecI plus VR
Insert site directed mutagenesis stuff here
7/9/07
-miniprep of site directed mutagenesis using QiaGen Miniprep kit
-purification of construct C1+C2 extension rxn R1 using QiaGen PCR purification protocol--labeled product 'FecA promoter biobrick'
-received E Coli AA93, plasmid pLCIRA, pGFPA' from Germany, waiting on instructions from Dr. Braun on how to plate them.
-grow E0240 in liquid culture
