IGEM:Cambridge/2008/Turing Pattern Formation/Primers

From OpenWetWare

< IGEM:Cambridge | 2008 | Turing Pattern Formation
Revision as of 12:29, 15 September 2008 by Daniel Goodman (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search


Promoter Primers

Temperatures were calculated using https://www.finnzymes.fi/tm_determination.html. The uppercase letters match the plasmid sequence, while the lowercase letters are 'bumper bases' for restriction cuts and the biobrick prefix and suffixes. Bumper bases, biobrick prefixes, and plasmid DNA are separated by spaces.

Primer name Parent vector init. length init. Tm init. GC% final length final Tm final GC
pXyl promoter forward pSG1154 (ECE153) 26 58.7+3 15.3% 50 80.0+3 34.0%
at gaattcgcggccgcttctagag TTCATGAAAAACTAAAAAAAATATTG
pXyl promoter reverse pSG1154 (ECE153) 26 bp 63.0+3 26.6 % 50 79.5+3 44.0%
gat ctgcagcggccgctactagta TATGTCATATTGTAAGTAAGTTGCAC
pSpac promoter forward pMUTIN-YFP (ECE151) 22 58.5+3 36.3% 46 82.6+3 45.6%
at gaattcgcggccgcttctagag AGAACAACCTCTGCTAAAATTC
pSpac promoter reverse pMUTIN-YFP (ECE151) 21 59.3+3 38.0% 45 80.4+3 46.6%
tat ctgcagcggccgctactagta AAGCTTAATTGTTATCCGCTC
pPac promoter forward pMUTIN-YFP (ECE151) 21 61.7+3 38.0% 45 84.5+3 46.6%
at gaattcgcggccgcttctagag AAACGAGGTCATCATTTCCTT
pPac promoter reverse pMUTIN-YFP (ECE151) 26 57.7+3 26.6% 50 82.1+3 46.0%
cgc ctgcagcggccgctactagta CAAATGTAGTCTTTGAAAGTATTACA
pUpp promoter forward pAD45-25 (ECE166) 22 58.8+3 27.2% 46 82.6+3 41.3%
at gaattcgcggccgcttctagag GATGAATAAATTTTGGCGATAT
pUpp promoter reverse pAD45-25 (ECE166) 25 60.9+3 36.0% 49 80.3+3 44.8%
tat ctgcagcggccgctactagta GAGGATCAAATACATACAGTTTTCC

Bacillus Biobrick pBSINT1 Primers

Primer name Parent vector init. length init. Tm init. GC% final length final Tm final GC
pBSINT1 bla+rep forward pSB1A3 20 62.9 50.0%
pBSINT1 bla+rep reverse pSB1A3 20 66.7 50.0%
pBSINT1 amyE front forward pDG1661 (ECE112) 20 63.6 50.0% 35 83.2+3 51.4%
 ttccccgaaaagtgc ccagtcttcacatcggtttg
pBSINT1 amyE front reverse pDG1661 (ECE112) 20 66.7 55.0% 35 83.1+3 57.1%
agacgtcaggtggca ctgcccgtatttcgcgtaag
pBSINT1 amyE back+cat forward pDG1661 (ECE112) 19 63.2 47.3% 34 78.1+3 47.0%
ctcaaaggcggtaat tttcgctacgctcaaatcc
pBSINT1 amyE back+cat reverse pDG1661 (ECE112) 20 66.5 55.0% 35 81.5+3 51.4%
catgttctttcctgc cctacaatccatgccaaccc
VF pSB1A3 20 63.8 50.0%
VR pSB1A3 20 63.4 50.0%
tat ctgcagcggccgctactagta GAGGATCAAATACATACAGTTTTCC

Bacillus RBS Primers

We made primer sets for 2 ribosomal binding sites in Bacillus of differing binding strengths. We expect B._sub_RBSs to bind very strongly because it is the consensus sequence for RBS in B. subtilis. Because of its small size, we also made detection primers for use with VF & VR (or temperature compatible alternates) to detect the RBS within the insert,

B. subtilis consensus RBS - http://www.ncbi.nlm.nih.gov/pubmed/10446248



RBS modified from ECE112 SpoVG RBS - http://www.bgsc.org/Catalogs/Catpart4.pdf


Primer name final length final Tm final GC
RBS s Detection forward 20 62.3 55.0%
RBS w Detection forward 20 63.4 60.0%

Agr Primers

  • These primers are to extract each part of the Agr operon so that a Bacillus RBS can replace the E. coli RBS currently attached to the genes.
agr senders
*5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAG ATGaactattttgacaacaa 3'
*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA  tttcagatcctctttgatg 3'

*5' CTT C GAATTC GCGGCCGC  T  TCTAG atgaatactctgttcaatctgtttt 3'

*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA ttcatgcagctgggtcagct 3'
agr receivers
*5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAG atgattctgatgttcaccat 3' 

*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA gttattgatgatttcgactt 3' 

*5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAG  atggaaatcgcactggcta 3'

*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA  gattttcttgacattgcgta 3'
Personal tools