IGEM:Cambridge/2008/Turing Pattern Formation/Primers: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(17 intermediate revisions by 3 users not shown)
Line 1: Line 1:
====Promoter Primers====
Temperatures were calculated using https://www.finnzymes.fi/tm_determination.html.
The uppercase letters match the plasmid sequence, while the lowercase letters are 'bumper bases' for restriction cuts and the biobrick prefix and suffixes. Bumper bases, biobrick prefixes, and plasmid DNA are separated by spaces.
{| class="wikitable" border="1"
|-
! Primer name
! Parent vector
! init. length
! init. Tm
! init. GC%
! final length
! final Tm
! final GC
|-
|pXyl promoter forward
|pSG1154 (ECE153)
| 26
| 58.7+3
| 15.3%
| 50
| 80.0+3
| 34.0%
|-
|colspan="8" align=center|<pre>at gaattcgcggccgcttctagag TTCATGAAAAACTAAAAAAAATATTG</pre>
|-
|pXyl promoter reverse
|pSG1154 (ECE153)
| 26 bp
| 63.0+3
| 26.6 %
| 50
| 79.5+3
| 44.0%
|-
|colspan="8" align=center|<pre>gat ctgcagcggccgctactagta TATGTCATATTGTAAGTAAGTTGCAC</pre>
|-
|pSpac promoter forward
|pMUTIN-YFP (ECE151)
| 22
| 58.5+3
| 36.3%
| 46
| 82.6+3
| 45.6%
|-
|colspan="8" align=center|<pre>at gaattcgcggccgcttctagag AGAACAACCTCTGCTAAAATTC</pre>
|-
|pSpac promoter reverse
|pMUTIN-YFP (ECE151)
| 21
| 59.3+3
| 38.0%
| 45
| 80.4+3
| 46.6%
|-
|colspan="8" align=center|<pre>tat ctgcagcggccgctactagta AAGCTTAATTGTTATCCGCTC</pre>
|-
|pPac promoter forward
|pMUTIN-YFP (ECE151)
| 21
| 61.7+3
| 38.0%
| 45
| 84.5+3
| 46.6%
|-
|colspan="8" align=center|<pre>at gaattcgcggccgcttctagag AAACGAGGTCATCATTTCCTT</pre>
|-
|pPac promoter reverse
|pMUTIN-YFP (ECE151)
| 26
| 57.7+3
| 26.6%
| 50
| 82.1+3
| 46.0%
|-
|colspan="8" align=center|<pre>cgc ctgcagcggccgctactagta CAAATGTAGTCTTTGAAAGTATTACA</pre>
|-
|pUpp promoter forward
|pAD45-25 (ECE166)
| 22
| 58.8+3
| 27.2%
| 46
| 82.6+3
| 41.3%
|-
|colspan="8" align=center|<pre>at gaattcgcggccgcttctagag GATGAATAAATTTTGGCGATAT</pre>
|-
|pUpp promoter reverse
|pAD45-25 (ECE166)
| 25
| 60.9+3
| 36.0%
| 49
| 80.3+3
| 44.8%
|-
|colspan="8" align=center|<pre>tat ctgcagcggccgctactagta GAGGATCAAATACATACAGTTTTCC</pre>
|-
|}
====Bacillus Biobrick pBSINT1 Primers====
{| class="wikitable" border="1"
|-
! Primer name
! Parent vector
! init. length
! init. Tm
! init. GC%
! final length
! final Tm
! final GC
|-
|pBSINT1 bla+rep forward
|pSB1A3
|
|
|
| 20
| 62.9
| 50.0%
|-
|colspan="8" align=center|<pre> GCAGGAAAGAACATGTGAGC</pre>
|-
|pBSINT1 bla+rep reverse
|pSB1A3
|
|
|
| 20
| 66.7
| 50.0%
|-
|colspan="8" align=center|<pre>GCACTTTTCGGGGAAATGTG</pre>
|-
|pBSINT1 amyE front forward
|pDG1661 (ECE112)
| 20
| 63.6
| 50.0%
| 35
| 83.2+3
| 51.4%
|-
|colspan="8" align=center|<pre> ttccccgaaaagtgc ccagtcttcacatcggtttg</pre>
|-
|pBSINT1 amyE front reverse
|pDG1661 (ECE112)
| 20
| 66.7
| 55.0%
| 35
| 83.1+3
| 57.1%
|-
|colspan="8" align=center|<pre>agacgtcaggtggca ctgcccgtatttcgcgtaag</pre>
|-
|pBSINT1 amyE back+cat forward
|pDG1661 (ECE112)
| 19
| 63.2
| 47.3%
| 34
| 78.1+3
| 47.0%
|-
|colspan="8" align=center|<pre>ctcaaaggcggtaat tttcgctacgctcaaatcc</pre>
|-
|pBSINT1 amyE back+cat reverse
|pDG1661 (ECE112)
| 20
| 66.5
| 55.0%
| 35
| 81.5+3
| 51.4%
|-
|colspan="8" align=center|<pre>catgttctttcctgc cctacaatccatgccaaccc</pre>
|-
|VF
|pSB1A3
|
|
|
| 20
| 63.8
| 50.0%
|-
|colspan="8" align=center|<pre>tgccacctgacgtctaagaa</pre>
|-
|VR
|pSB1A3
|
|
|
| 20
| 63.4
| 50.0%
|-
|colspan="8" align=center|<pre>tat ctgcagcggccgctactagta GAGGATCAAATACATACAGTTTTCC</pre>
|-
|}
====Bacillus RBS Primers====
====Bacillus RBS Primers====
We made primer sets for 2 ribosomal binding sites in Bacillus of differing binding strengths. We expect B._sub_RBSs to bind very strongly because it is the consensus sequence for RBS in B. subtilis.
We made primer sets for 2 ribosomal binding sites in Bacillus of differing binding strengths. We expect B._sub_RBSs to bind very strongly because it is the consensus sequence for RBS in B. subtilis. Because of its small size, we also made detection primers for use with VF & VR (or temperature compatible alternates) to detect the RBS within the insert,


<pre>
<pre>
Line 20: Line 228:
*5' CTGCAGCGGCCGCTACTAGTAACA CCACCTCT CTCT 3'</pre>
*5' CTGCAGCGGCCGCTACTAGTAACA CCACCTCT CTCT 3'</pre>


{| class="wikitable" border="1"
|-
! Primer name
! final length
! final Tm
! final GC
|-
|RBS s Detection forward
| 20
| 62.3
| 55.0%
|-
|colspan="8" align=center|<pre>CCGCTTCTAGAG AAAGGAGG</pre>
|-
|RBS w Detection forward
| 20
| 63.4
| 60.0%
|-
|colspan="8" align=center|<pre>CCGCTTCTAGAG AGAGGTGG</pre>
|-
|}


====Agr Primers====
====Agr Primers====

Latest revision as of 09:29, 15 September 2008

Promoter Primers

Temperatures were calculated using https://www.finnzymes.fi/tm_determination.html. The uppercase letters match the plasmid sequence, while the lowercase letters are 'bumper bases' for restriction cuts and the biobrick prefix and suffixes. Bumper bases, biobrick prefixes, and plasmid DNA are separated by spaces.

Primer name Parent vector init. length init. Tm init. GC% final length final Tm final GC
pXyl promoter forward pSG1154 (ECE153) 26 58.7+3 15.3% 50 80.0+3 34.0%
at gaattcgcggccgcttctagag TTCATGAAAAACTAAAAAAAATATTG
pXyl promoter reverse pSG1154 (ECE153) 26 bp 63.0+3 26.6 % 50 79.5+3 44.0%
gat ctgcagcggccgctactagta TATGTCATATTGTAAGTAAGTTGCAC
pSpac promoter forward pMUTIN-YFP (ECE151) 22 58.5+3 36.3% 46 82.6+3 45.6%
at gaattcgcggccgcttctagag AGAACAACCTCTGCTAAAATTC
pSpac promoter reverse pMUTIN-YFP (ECE151) 21 59.3+3 38.0% 45 80.4+3 46.6%
tat ctgcagcggccgctactagta AAGCTTAATTGTTATCCGCTC
pPac promoter forward pMUTIN-YFP (ECE151) 21 61.7+3 38.0% 45 84.5+3 46.6%
at gaattcgcggccgcttctagag AAACGAGGTCATCATTTCCTT
pPac promoter reverse pMUTIN-YFP (ECE151) 26 57.7+3 26.6% 50 82.1+3 46.0%
cgc ctgcagcggccgctactagta CAAATGTAGTCTTTGAAAGTATTACA
pUpp promoter forward pAD45-25 (ECE166) 22 58.8+3 27.2% 46 82.6+3 41.3%
at gaattcgcggccgcttctagag GATGAATAAATTTTGGCGATAT
pUpp promoter reverse pAD45-25 (ECE166) 25 60.9+3 36.0% 49 80.3+3 44.8%
tat ctgcagcggccgctactagta GAGGATCAAATACATACAGTTTTCC

Bacillus Biobrick pBSINT1 Primers

Primer name Parent vector init. length init. Tm init. GC% final length final Tm final GC
pBSINT1 bla+rep forward pSB1A3 20 62.9 50.0%
 GCAGGAAAGAACATGTGAGC
pBSINT1 bla+rep reverse pSB1A3 20 66.7 50.0%
GCACTTTTCGGGGAAATGTG
pBSINT1 amyE front forward pDG1661 (ECE112) 20 63.6 50.0% 35 83.2+3 51.4%
 ttccccgaaaagtgc ccagtcttcacatcggtttg
pBSINT1 amyE front reverse pDG1661 (ECE112) 20 66.7 55.0% 35 83.1+3 57.1%
agacgtcaggtggca ctgcccgtatttcgcgtaag
pBSINT1 amyE back+cat forward pDG1661 (ECE112) 19 63.2 47.3% 34 78.1+3 47.0%
ctcaaaggcggtaat tttcgctacgctcaaatcc
pBSINT1 amyE back+cat reverse pDG1661 (ECE112) 20 66.5 55.0% 35 81.5+3 51.4%
catgttctttcctgc cctacaatccatgccaaccc
VF pSB1A3 20 63.8 50.0%
tgccacctgacgtctaagaa
VR pSB1A3 20 63.4 50.0%
tat ctgcagcggccgctactagta GAGGATCAAATACATACAGTTTTCC

Bacillus RBS Primers

We made primer sets for 2 ribosomal binding sites in Bacillus of differing binding strengths. We expect B._sub_RBSs to bind very strongly because it is the consensus sequence for RBS in B. subtilis. Because of its small size, we also made detection primers for use with VF & VR (or temperature compatible alternates) to detect the RBS within the insert,

B. subtilis consensus RBS - http://www.ncbi.nlm.nih.gov/pubmed/10446248

B._sub_RBSs_F
*5' GAATTCGCGGCCGCTTCTAGAG AAAGGAGG TGTTA 3'

B._sub_RBSs_R
*5' CTGCAGCGGCCGCTACTAGTAACA CCTCCTTT CTCT 3'


RBS modified from ECE112 SpoVG RBS - http://www.bgsc.org/Catalogs/Catpart4.pdf

B._sub_RBSw_F
*5' GAATTCGCGGCCGCTTCTAGAG AGAGGTGG TGTTA 3'

B._sub_RBSw_R
*5' CTGCAGCGGCCGCTACTAGTAACA CCACCTCT CTCT 3'
Primer name final length final Tm final GC
RBS s Detection forward 20 62.3 55.0%
CCGCTTCTAGAG AAAGGAGG
RBS w Detection forward 20 63.4 60.0%
CCGCTTCTAGAG AGAGGTGG

Agr Primers

  • These primers are to extract each part of the Agr operon so that a Bacillus RBS can replace the E. coli RBS currently attached to the genes.
agr senders
Agr_B_F
*5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAG ATGaactattttgacaacaa 3'
 
Agr_B_R 
*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA  tttcagatcctctttgatg 3'

Agr_D_F
*5' CTT C GAATTC GCGGCCGC  T  TCTAG atgaatactctgttcaatctgtttt 3'

Agr_D_R
*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA ttcatgcagctgggtcagct 3'
agr receivers
Agr_C_F
*5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAG atgattctgatgttcaccat 3' 

Agr_C_R
*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA gttattgatgatttcgactt 3' 

Agr_A_F
*5' GTTTCTT C GAATTC GCGGCCGC  T  TCTAG  atggaaatcgcactggcta 3'

Agr_A_R
*5' TT C CTGCAG CGGCCGC  T  ACTAGT A TTATTA  gattttcttgacattgcgta 3'