IGEM:Cambridge/2008/Notebook/Voltage/Gene Design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 34: Line 34:


==Promoter and RBS Selection==
==Promoter and RBS Selection==
===Promoter===
===Promoter===
===Promoter===
*The promoter chosen for use with Kdp was OsmY [http://partsregistry.org/Part:BBa_J45992 (Part BBa_J45992).]  
*The promoter chosen for use with Kdp was OsmY [http://partsregistry.org/Part:BBa_J45992 (Part BBa_J45992).]  
*It is a stationary phase promoter, and since we require high cell densities in our final "voltage measurement" medium, we want Kdp to only be expressed in stationary phase.  
*It is a stationary phase promoter, and since we require high cell densities in our final "voltage measurement" medium, we want Kdp to only be expressed in stationary phase.  
*This will reduce the metabolic and osmotic stress on dividing cells in exponential phase.
*This will reduce the metabolic and osmotic stress on dividing cells in exponential phase.
===Ribosome Binding Site===
*Three different strength RBSs were investigated, [http://partsregistry.org/Part:BBa_B0030 B0030], [http://partsregistry.org/Part:BBa_B0031 B0031] and [http://partsregistry.org/Part:BBa_B0032 B0032].
*B0030 is the strongest(15bp length), B0031 medium(14bp) and B0032 weakest(13bp).
*Investigating three will help us determine the optimum levels


==Amplification from E.coli MG1655==
==Amplification from E.coli MG1655==

Revision as of 09:11, 4 September 2008

KdpF-C Biobrick

Gene Selection

  • Kdp is a well documented P-Type K+ ATPase found naturally in E.coli, used to actively pump ions into the cell.
  • It consists of a 6-gene operon: F,A,B,C,D,E Where F-C are the functional membrane protein subunits, and D-E comprises a bacterial 2-component regulatory system.

  • Literature shows that Kdp acts as a high-affinity transport system, and works most effectively at low external potassium concentrations, where a change in ion flux would be most likely to produce a measurable voltage difference.
  • The D-E 2-component system consists of a membrane protein turgidity sensor and a transcription factor. It controls Kdp operon expression in vivo, by reducing gene expression when turgor is high.
  • Since we wish to over-express Kdp, we decided not to include the regulatory system in our biobrick. (Osmotic buffering would be used instead.)

Amplification from E.coli MG1655

  • This was performed via PCR amplification of the genome template using the following primers:
         -Forward: ATATGAATTCATATTCTAGATGAGTGCAGGCGTGATAACCGGCGTATT 
                       EcoRI      XbaI
         -Reverse: CTCTCTGCAGCTCTACTAGTTTATTCATCAAGTTTATCCAGCGCCAGAT
                       PstI       SpeI 
  • Primer overhangs incorporated the biobrick prefix and suffix into the section, restriction sites shown in bold .
  • The result of this PCR is shown below:

Integration into Vector

  • The vector used was low copy-number plasmid pSB4C5, with chloramphenicol resistance and a death gene as selection markers.
  • Kdp PCR product and pSB4C5 were both cut with EcoRI & SpeI, (vector backbone was dephosphorylated to prevent circularisation) then ligation into the vector can occur as shown.
  • . . . . . . . . . . . . . . . . . . . . . . . .
  • Note: pSB4C5_Kdp biobrick plasmid has no promoter/RBS and so Kdp is not expressed in transformants.

Promoter+RBS Biobrick

Promoter and RBS Selection

Promoter

Promoter

  • The promoter chosen for use with Kdp was OsmY (Part BBa_J45992).
  • It is a stationary phase promoter, and since we require high cell densities in our final "voltage measurement" medium, we want Kdp to only be expressed in stationary phase.
  • This will reduce the metabolic and osmotic stress on dividing cells in exponential phase.

Ribosome Binding Site

  • Three different strength RBSs were investigated, B0030, B0031 and B0032.
  • B0030 is the strongest(15bp length), B0031 medium(14bp) and B0032 weakest(13bp).
  • Investigating three will help us determine the optimum levels

Amplification from E.coli MG1655

Integration into Vector

GluR0 Biobrick

Gene Selection

DNA Synthesis