Revision as of 07:31, 4 September 2008

KdpF-C Biobrick

Kdp is a well documented P-Type K+ ATPase found naturally in E.coli, used to actively pump ions into the cell.
It consists of a 6-gene operon: F,A,B,C,D,E Where F-C are the functional membrane protein subunits, and D-E comprises a bacterial 2-component regulatory system.

Literature shows that Kdp acts as a high-affinity transport system, and works most effectively at low external potassium concentrations, where a change in ion flux would be most likely to produce a measurable voltage difference.
The D-E 2-component system consists of a membrane protein turgidity sensor and a transcription factor. It controls Kdp operon expression in vivo, by reducing gene expression when turgor is high.
Since we wish to over-express Kdp, we decided not to include the regulatory system in our biobrick. (Osmotic buffering would be used instead.)

This was performed via PCR amplification of the genome template using the following primers:

         -Forward: ATATGAATTCATATTCTAGATGAGTGCAGGCGTGATAACCGGCGTATT 
                       EcoRI      XbaI

         -Reverse: CTCTCTGCAGCTCTACTAGTTTATTCATCAAGTTTATCCAGCGCCAGAT
                       PstI       SpeI

Primer overhangs incorporated the biobrick prefix and suffix into the section, restriction sites shown in bold .
The result of this PCR is shown below:

@@ Line 16: / Line 16: @@
                          ''EcoRI''      ''XbaI''
-           -Reverse: CTCTCTGCAGCTCTACTAGTTTATTCATCAAGTTTATCCAGCGCCAGAT
+           -Reverse: CTCT'''CTGCAG'''CTCT'''ACTAGT'''TTATTCATCAAGTTTATCCAGCGCCAGAT
+                        ''PstI''       ''SpeI''
 *Primer overhangs incorporated the biobrick prefix and suffix into the section, restriction sites shown in '''bold''' .
 *The result of this PCR is shown below:
+[[Image:kdp pcr prod.JPG]]
 ==Integration into Vector==