IGEM:Cambridge/2008/Notebook/Voltage/Gene Design

KdpF-C Biobrick

Gene Selection

• Kdp is a well documented P-Type K+ ATPase found naturally in E.coli, used to actively pump ions into the cell.
• It consists of a 6-gene operon: F,A,B,C,D,E Where F-C are the functional membrane protein subunits, and D-E comprises a bacterial 2-component regulatory system.

• Literature shows that Kdp acts as a high-affinity transport system, and works most effectively at low external potassium concentrations, where a change in ion flux would be most likely to produce a measurable voltage difference.
• The D-E 2-component system consists of a membrane protein turgidity sensor and a transcription factor. It controls Kdp operon expression in vivo, by reducing gene expression when turgor is high.
• Since we wish to over-express Kdp, we decided not to include the regulatory system in our biobrick. (Osmotic buffering would be used instead.)

Amplification from E.coli MG1655

• This was performed via PCR amplification of the genome template using the following primers:

         -Forward: ATAT GAATTC ATAT TCTAGA TGAGTGCAGGCGTGATAACCGGCGTATT 
                        EcoRI        XbaI

         -Reverse: CTCT CTGCAG CTCT ACTAGT TTATTCATCAAGTTTATCCAGCGCCAGAT
                        PstI         SpeI 

• Primer overhangs incorporated the biobrick prefix and suffix into the section, restriction sites shown in bold .
• The result of this PCR is shown below:

Integration into Vector

• The vector used was low copy-number plasmid pSB4C5, with chloramphenicol resistance and a death gene as selection markers.
• Kdp PCR product and pSB4C5 were both cut with EcoRI & SpeI, (vector backbone was dephosphorylated to prevent circularisation) then ligation into the vector can occur as shown.

• . . . . . . . . . . . . . . . . . . . . . . . .
• Note: pSB4C5_Kdp biobrick plasmid has no promoter/RBS and so Kdp is not expressed in transformants.

Promoter+RBS Biobrick

Promoter and RBS Selection

Promoter

• The promoter chosen for use with Kdp was OsmY (Part BBa_J45992).
• It is a stationary phase promoter, and since we require high cell densities in our final "voltage measurement" medium, we want Kdp to only be expressed in stationary phase.
• This will reduce the metabolic and osmotic stress on dividing cells in exponential phase.

Ribosome Binding Site

• Three different strength RBSs were investigated, B0030, B0031 and B0032.
• B0030 is the strongest(15bp length), B0031 medium(14bp) and B0032 weakest(13bp).
• Investigating three will help us determine the optimum levels of Kdp expression.

Amplification from E.coli MG1655

• These parts were extracted using PCR from the Registry of Standard Biological Parts. However, the RBS biobricks are so small that we built their sequences into the reverse primers.
• The primer sequences used are:

         -Forward: CTAT GAATTC ATAT TCTAGA GCTGGCACAGGAACGTTATCC (All OsmY-RBS constructs)
                        EcoRI        XbaI

         -B0030 Reverse: CGCG CTGCAG CTCT ACTAGT (TTTCTCCTCTTTAAT)TTGTTAAATATAGA
                               PstI        SpeI      B0030
         
         -B0031 Reverse: CTCT CTGCAG CTCT ACTAGT (GGTTTCCTGTGTGA)TTGTTAAATATAGAT
                               PstI        SpeI      B0031
         
         -B0032 Reverse: CTCT CTGCAG CTCT ACTAGT (CTTTCCTGTGTGA)TTGTTAAATATAGATCA
                               PstI        SpeI      B0032

• PCR with these primers creates three different promoter-RBS biobrick parts (OsmY-B003x):

Integration into Vector

• The vector used was low copy-number plasmid pSB4C5, with chloramphenicol resistance and a death gene as selection markers.
• OsmY-B003x and pSB4C5 were both cut with XbaI & SpeI, (vector backbone was dephosphorylated to prevent circularisation) then ligation into the vector can occur as shown:

• . . . . . . . . . . . . . . . . . . . . . .

• Note: This promoter-RBS construct did not cause unwanted transcript problems because there are many double terminators scattered throughout the pSB4C5 backbone.

Combination of Kdp, OsmY and B003x

• This will create a functional biobrick plasmid in which Kdp is overexpressed only in stationary phase of growing cells.

• Cut pSB4C5-Kdp with XbaI and PstI
• Cut pSB4C5-OsmY-B003x with PstI first, then SpeI, in order to make sure Pst cuts correctly.
• Ligation will form the following functional plasmid:

GluR0 Biobrick

Gene Selection

• In order to create a measurable voltage change when a chemical was "recognised" we decided to use an ionotropic ligand-gated potassium efflux channel that binds glutamate. This also simulates the action of glutamate as a neurotransmitter in the CNS.
• The gene chosen comes from the cyanobacteria Synechocystis sp. PCC 6803. This species is gram negative (similar to E.coli) and is used as a paradigm for evolutionary research concerning the AMPA receptor proteins.
• GluR0 is a well characterised glutamate-gated K+ membrane channel, which has a considerable degree of structural and functional homology to rat neurone GluR2 AMPA receptors, see the paper Functional Characterisation of a Glutamate-gated Potassium Channel

DNA Synthesis

• The protein sequence was obtained via NCBI from the Synechocystis sp. PCC 6803 genome.
• The gene sequence could not be directly used because of codon optimisation problems (Synechocystis uses many codons that are "rare" in E.coli"
• The protein sequence was back-translated to DNA using GeneDesigner™ and codons were assigned using the E.coli usage table.
• The promoter BBa_J23116, RBS BBa_J61117 and Biobrick prefix and suffix sequences were added to the design.
• Finally, unwanted restriction sites within the gene(EcoRI, XbaI, SpeI and PstI) were manually removed by selecting alternative codons for any given amino acid.
• The gene was synthesised and sequenced by DNA2.0 into one of their standard vectors.