Haynes:TypeIIS Assembly: Difference between revisions
No edit summary |
No edit summary |
||
(13 intermediate revisions by the same user not shown) | |||
Line 12: | Line 12: | ||
'''Use PCR to prepare the parts''' | {| width=800px cellpadding=5 | ||
|- valign="top" | |||
| <font size=3>'''Use PCR to prepare the parts'''</font> | |||
| | |||
* Multiple parts can be assembled in one step. | * Multiple parts can be assembled in one step. | ||
* Parts and the destination vector should be amplified by PCR. | * Parts and the destination vector should be amplified by PCR. | ||
* Make sure that none of the parts/ vector have any BsmBI sites! | * Make sure that none of the parts/ vector have any BsmBI sites! | ||
|- | |- | ||
| [[Image:Haynes_TIIS_fig1.png|250px|Figure 1]] || First, map out your assembly. In this example, three parts, A, B, and C will be assembled and inserted into a Vector. | | [[Image:Haynes_TIIS_fig1.png|250px|Figure 1]] || First, map out your assembly. In this example, three parts, A, B, and C will be assembled and inserted into a Vector. | ||
Line 26: | Line 27: | ||
* Reverse Primer: 5'-'''<font color=#666666>cacacca</font>CGTCTCa + <font color=#660099>15 bp of "Vector left" bottom strand</font>'''<br> | * Reverse Primer: 5'-'''<font color=#666666>cacacca</font>CGTCTCa + <font color=#660099>15 bp of "Vector left" bottom strand</font>'''<br> | ||
'''pSB1A3 Vector Primers''' - already available in the Haynes lab freezer | '''pSB1A3 Vector Primers''' - already available in the Haynes lab freezer | ||
* Forward Primer gg0001: 5'-'''<font color=#666666>cacacca</font>CGTCTCa<font color=#660099> | * Forward Primer gg0001: 5'-'''<font color=#666666>cacacca</font>CGTCTCa<font color=#660099>actagtagcggccgctgcag</font>''' | ||
* Reverse Primer gg0002: 5'-'''<font color=#666666>cacacca</font>CGTCTCa<font color=#660099> | * Reverse Primer gg0002: 5'-'''<font color=#666666>cacacca</font>CGTCTCa<font color=#660099>tctagaagcggccgcgaattcc</font>''' | ||
<br> | <br> | ||
|- | |- | ||
Line 46: | Line 47: | ||
Note: For insertion into pSB1A3, "4 bp of Vector right bottom strand" = <font color=#660099>'''TAGT'''</font> | Note: For insertion into pSB1A3, "4 bp of Vector right bottom strand" = <font color=#660099>'''TAGT'''</font> | ||
<br> | <br> | ||
|- | |- valign="top" | ||
| [[Image:Haynes_TIIS_fig6.png|250px|Figure 6]] || Run separate 50 μL PCR reactions for each part. If you are using plasmid DNA as a template, use no more than 10 ng in order to minimize carry-over into the final bacterial transformation step. Check 10 μL of the reaction on and agarose gel. Purify the remaining 40 μL of PCR products using a Zymo clean and Concentrator kit (or similar PCR clean up kit). | | [[Image:Haynes_TIIS_fig6.png|250px|Figure 6]] || Run separate 50 μL PCR reactions for each part. If you are using plasmid DNA as a template, use no more than 10 ng in order to minimize carry-over into the final bacterial transformation step. Check 10 μL of the reaction on and agarose gel. Purify the remaining 40 μL of PCR products using a Zymo clean and Concentrator kit (or similar PCR clean up kit). | ||
'''Digestion/ ligation reaction''' | |||
|- valign="top" | |||
| <br><font size=3>'''Digestion/ ligation reaction'''</font> | |||
| <br>'''Dilute the purified PCR product to 20 fmol/μL''' | |||
* Measure ng/μL of the purified sample. | |||
* The volume of purified DNA (x) you will need to dilute in a final volume of 20 μL = '''length in bp''' ÷ '''measured ng/μL''' * ''20 fmols/μL * 650 fg/fmol ÷ 1,000,000 fg/ng'' * 20 μL final volume | |||
** Formula: x = '''length in bp''' ÷ '''measured ng/μL''' * ''0.013'' * 20 | |||
** Note: final volume can be changed by changing the last number from 20 to something else. | |||
|- | |- | ||
| | | [[Image:Haynes_TIIS_fig7.png|250px|Figure 7]] | ||
| '''Perform BsmBI/ T4 ligase mediated assembly''' | |||
* BsmBI cuts the DNA fragments and creates complementary overhangs. | |||
** | * Complementary sticky ends anneal via base pairing. | ||
* T4 ligase seals gaps in the phosphodiester DNA backbone. | |||
{| {{table}} | {| {{table}} | ||
|- | |- | ||
Line 87: | Line 90: | ||
'''Bacterial transformation''' | <font size=3>'''Bacterial transformation'''</font> | ||
* Add total volume (10.0 μL) to 50 μL chemically competent cells (e.g., BL21) in a 2.0 mL tube. | * Add total volume (10.0 μL) to 50 μL chemically competent cells (e.g., BL21) in a 2.0 mL tube. | ||
* Incubate on ice for 2 min., heat shock at 42°C for exactly | * Incubate on ice for 2 min., heat shock at 42°C for exactly 45 sec., immediately place on ice. | ||
* Add 800 μL sterile SOC medium. | * Add 800 μL sterile SOC medium. | ||
* Grow with shaking at 37°C for 30 min. | * Grow with shaking at 37°C for 30 min. |
Revision as of 18:13, 12 September 2013
by Karmella Haynes, 2013
Principle: The familiar "BioBrick cloning" enzymes (i.e., EcoRI, NotI, XbaI, SpeI, PstI) are Type II restriction enzymes, which cut the sequences that they specifically bind to. The Type IIS Assembly method uses a Type IIS restriction enzyme, which binds at a specific sequence and cuts at a non-specific location exactly five base pairs away. As a result, the enzyme cleaves away its own binding site and leaves behind the most useful feature of assembly, sticky overhangs. When designed properly, Type IIS sites can be used to perform seamless assembly of parts. As an added convenience, this protocol allows cutting and ligation to occur in a single tube, as a single reaction. Thus, gel purification steps can be eliminated.
This protocol uses the Type IIS restriction enzyme BsmBI (CGTCTCn/nnnn).
Bacterial transformation
- Add total volume (10.0 μL) to 50 μL chemically competent cells (e.g., BL21) in a 2.0 mL tube.
- Incubate on ice for 2 min., heat shock at 42°C for exactly 45 sec., immediately place on ice.
- Add 800 μL sterile SOC medium.
- Grow with shaking at 37°C for 30 min.
- Pellet the cells at top speed in a microcentrifuge for 3 min. at room temp.
- Discard the supernatant. Resuspend the cells in 100 μL LB + antibiotic.
- Plate cells on pre-warmed LB agar + antibiotic. Grow overnight at 37°C.
- Quick-transormation (e.g., DH5α-Turbo) is not recommended