Haynes:Making BioBricks
Making Standardized DNA Parts
Or, Less Expensive Alternatives to DNA Synthesis
- Double-stranded Oligo Insert: A part that is smaller than ~85 bp can be made into an oligonucleotide insert.
- Overlapping Oligos: A part that is between ~ 85 - 150 bp can be assembled from smaller overlapping oligonucleotides.
- PCR Amplification: For a part that is larger than ~150 bp and is based on an existing DNA fragment, use PCR amplification of the existing DNA.
Double-stranded Oligo Insert
UPDATED: 5/19/15
Credit: Rene Davis (Haynes Lab) and protocol from the Zhang lab at MIT
1. Design your oligos: An oligo insert should have a XbaI sticky end upstream of the part, SpeI and NotI sites downstream, and a PstI sticky end downstream.
Sense oligo: | 5' CTAGA[coding sequence]ACTAGTAGCGGCCGCTGCA 3' |
Anti-sense oligo: | 5' GCGGCCGCTACTAGT[reverse complement of coding sequence]T 3' |
Double stranded result:
5' ctaga [coding sequence] actagt a gcggccgctgca 3'
| ||||||||||||||||| |||||| | ||||||||
3' t [rev. comp. seq.] tgatca t cgccggcg 5'
2. Have the oligos synthesized (you can order through a company like www.idtdna.com). They do not require 5' phosphates.
3. Set up an annealing/ phosphorylation reaction as follows:
Sense oligo (100 μM) | 1.0 μl |
Anti-sense oligo (100 μM) | 1.0 μl |
10x T4 ligation Buffer (NEB) | 1.0 μl |
T4 PNK (NEB) | 0.5 μl |
dH2O | 6.5 μl |
10 μl |
Thermal cycler program:
- 37°C, 30 min
- 95°C, 5 min
- Ramp down to 25°C, 5°C/1 min. [90/1 min, 85/1 min, 80/1 min, ... 25°C/1 min]
- 25°C, ∞
Dilute the product(s) 1:250
- Add 2 μL product to 498 μL dH2O
4. Using 2.0 μL of the 1:250 diluted dsOligo per 50 - 100 ng vector works well in our hands. If you prefer to calculate the amount of insert needed to set up a specific ratio of insert to vector for the ligation, use this formula to estimate ng/μl of the oligo insert:
[(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 /
μl dH2O used to dissolve dry oligo 2) * 1.0 μl] / 20 μl
5. Ligate the double-stranded insert into a linearized vector with XbaI and PstI ends and transform into E. coli. (use any standard ligation/ transformation protocol)
Overlapping Oligos
[Top left][ other ][ other ][Top right]
|||||||||||||||||||||||||||||||||||||||||
[Bottom left ][ other ][ Bottom right ]
Input the desired full length sequence in the large text field. Click the check box by Add BioBrick Prefix and Suffix.
Choose "Custom Prefix" and enter:
- ctaga (top strand)
- t (bottom strand)
Choose "Custom Suffix" and enter:
- actagtagcggccgctgca (top strand)
- tgatcatcgccggcg (bottom strand)
5' ctaga [Top left][ other ][ other ][Top right] actagt a gcggccgctgca 3'
| ||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||
3' t [Bottom left ][ other ][ Bottom right ] tgatca t cgccggcg 5'
3. Set up an annealing reaction as follows:
Oligo (100 μM) | 3.0 μl of each |
10x annealing buffer* | 2.0 μl |
dH2O | ____ μl |
20 μl |
Heat at 100°C for 5 min., remove the entire heat block or water bath from the heat source, and allow to cool slowly to room temperature.
--> *10x annealing buffer: 1 M NaCl; 100 mM Tris-HCl, pH 7.4
4. Use this formula to estimate ng/μl of the oligo insert:
[(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 / μl dH2O used to dissolve dry oligo 2 + …n) * 3 μl] / 20 μl
5. Ligate the double-stranded insert into a linearized vector with XbaI and PstI ends and transform into E. coli. (use any standard ligation/ transformation protocol)
PCR Amplification
1. Design your primers: For typical BioBrick construction, you want a PCR product that has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part (with extra bases at each end to aid restriction digestion).
Forward primer: | 5' CCTTTCTAGA [15-20 bp of the coding strand] 3' |
Reverse primer: | 5' AAGGCTGCAGCGGCCGCTACTAGT [15-20 bp reverse complement] 3' |
Here is what your final double stranded product will look like:
5' [cctt tctaga f-primer >][Coding sequence][actagt a gcggccgctgca gcctt] 3'
|||| |||||| |||||||||||||||||||||||||||| |||||| | |||||||||||| |||||
3' [ggaa agatct][Rev. Comp. Seq.][< r-primer tgatca t cgccggcgacgt cggaa] 5'
2. Have the primers (oligos) synthesized (you can order through a company like www.idtdna.com).
Note: A typical PCR reaction contains DNA template, forward and reverse primers, deoxynucleotide triphosphates (dNTP’s), Taq (Thermus aquaticus) polymerase, MgCl2, and a reaction buffer.
3. The following is a PCR reaction that uses Promega GoTaq Green master mix (contains dNTP’s, Taq, MgCl2, and buffer).
DNA template | 0.4 μl |
Forward primer (10 μM) | 1.0 μl |
Reverse primer (10 μM) | 1.0 μl |
2x GoTaq master mix | 25 μl |
dH2O | 22.6 μl |
50 μl |
PCR reaction:
- 95°C/ 3 min.
- (95°C/ 30 sec; 55°C*/ 30 sec; 72°C/ ___ sec**) x30 cycles
- 72°C/ 3 min.
- 4°C/ ∞
--> *This is the annealing temperature, which needs to be adjusted depending upon the Tm of the oligos
--> **For products 1 kb or less, 30 seconds is sufficient. For products larger than 1 kb, use 60 sec. per kb
4. Check 2 μl of the reaction via DNA gel electrophoresis.
5. Clean the remainder of the PCR-amplified DNA using the Zymo clean and concentrator kit (or QIAGEN PCR clean-up).
6. Digest the DNA with XbaI/ PstI, gel purify (or “QIAGEN PCR-clean”) the product, and use it as an insert it into a XbaI/ PstI linearized vector (e.g., V0120).