Haynes:Making BioBricks

<- Back to Protocols

Making Standardized DNA Parts
Or, Less Expensive Alternatives to DNA Synthesis

By Karmella Haynes, 2012

First, identify a DNA “module” (e.g. promoter, coding region, etc.) and determine whether it contains any BioBrick cloning sites. If so, use site-directed mutagenesis or some other method to eliminate the sites without compromising the function of the module (e.g., silent mutation in a protein-coding sequence). Next, use one of the following methods to flank the module with BioBrick ends:

• Double-stranded Oligo Insert: A part that is smaller than ~85 bp can be made into an oligonucleotide insert.
• Overlapping Oligos: A part that is between ~ 85 - 150 bp can be assembled from smaller overlapping oligonucleotides.
• PCR Amplification: For a part that is larger than ~150 bp and is based on an existing DNA fragment, use PCR amplification of the existing DNA.

Double-stranded Oligo Insert

UPDATED: 5/19/15
Credit: Rene Davis (Haynes Lab) and protocol from the Zhang lab at MIT

1. Design your oligos: An oligo insert should have a XbaI sticky end upstream of the part, SpeI and NotI sites downstream, and a PstI sticky end downstream.

Sense oligo:	5' CTAGA[coding sequence]ACTAGTAGCGGCCGCTGCA 3'
Anti-sense oligo:	5' GCGGCCGCTACTAGT[reverse complement of coding sequence]T 3'

Double stranded result:

5' ctaga [coding sequence] actagt a gcggccgctgca 3'
| ||||||||||||||||| |||||| | ||||||||
3' t [rev. comp. seq.] tgatca t cgccggcg 5'

2. Have the oligos synthesized (you can order through a company like www.idtdna.com). They do not require 5' phosphates.

3. Set up an annealing/ phosphorylation reaction as follows:

Sense oligo (100 μM)	1.0 μl
Anti-sense oligo (100 μM)	1.0 μl
10x T4 ligation Buffer (NEB)	1.0 μl
T4 PNK (NEB)	0.5 μl
dH2O	6.5 μl
	10 μl

Thermal cycler program:

• 37°C, 30 min
• 95°C, 5 min
• Ramp down to 25°C, 5°C/1 min. [90/1 min, 85/1 min, 80/1 min, ... 25°C/1 min]
• 25°C, ∞

Dilute the product(s) 1:250

• Add 2 μL product to 498 μL dH₂O

4. Ligate the double-stranded insert into a linearized vector with XbaI and PstI ends and transform into E. coli. (use any standard ligation/ transformation protocol)
Note: Using 2.0 μL of the 1:250 diluted dsOligo per 50 - 100 ng vector works well in our hands. If you prefer to calculate the amount of insert needed to set up a specific ratio of insert to vector for the ligation, use this formula to estimate ng/μl of the oligo insert:
[(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 / μl dH2O used to dissolve dry oligo 2) * 1.0 μl] / 20 μl

Overlapping Oligos

1. Design your oligos: You can use software, such as “The Oligator” (Davidson College, http://gcat.davidson.edu/igem10/), to determine the optimal length and number of oligos for building your BioBrick. An example of Oligator output is shown below:

[Top left][  other  ][ other ][Top right]
|||||||||||||||||||||||||||||||||||||||||
[Bottom left ][  other  ][ Bottom right ]

Input the desired full length sequence in the large text field. Click the check box by Add BioBrick Prefix and Suffix.
Choose "Custom Prefix" and enter:

• ctaga (top strand)
• t (bottom strand)

Choose "Custom Suffix" and enter:

• actagtagcggccgctgca (top strand)
• tgatcatcgccggcg (bottom strand)

The final insert will have a XbaI sticky end upstream of the part, SpeI and NotI sites downstream, and a PstI sticky end downstream. Final double stranded result:

5' ctaga [Top left][  other  ][ other ][Top right] actagt a gcggccgctgca 3'
| ||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||
3' t [Bottom left ][  other  ][ Bottom right ] tgatca t cgccggcg 5'

2. Have the oligos synthesized (you can order through a company like www.idtdna.com). Note: To avoid self-ligation of the oligo insert during the final ligation, do not add 5’ phosphates to the oligos. DNA nicks in the insert-vector ligation will be repaired via plasmid replication in E. coli.

3. Set up an annealing reaction as follows:

Oligo (100 μM)	3.0 μl of each
10x annealing buffer*	2.0 μl
dH2O	____ μl
	20 μl

Heat at 100°C for 5 min., remove the entire heat block or water bath from the heat source, and allow to cool slowly to room temperature.
--> *10x annealing buffer: 1 M NaCl; 100 mM Tris-HCl, pH 7.4

4. Use this formula to estimate ng/μl of the oligo insert:
[(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 / μl dH2O used to dissolve dry oligo 2 + …n) * 3 μl] / 20 μl

5. Ligate the double-stranded insert into a linearized vector with XbaI and PstI ends and transform into E. coli. (use any standard ligation/ transformation protocol)

PCR Amplification

UPDATED: 05/19/15
Credit: Karmella Haynes

1. Design your primers: For typical BioBrick construction, you want a PCR product that has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part (with extra bases at each end to aid restriction digestion).

Forward primer:	5' CCTTTCTAGA [15-20 bp of the coding strand] 3'
Reverse primer:	5' AAGGCTGCAGCGGCCGCTACTAGT [15-20 bp reverse complement] 3'

Here is what your final double stranded product will look like:

5' [cctt tctaga f-primer >][Coding sequence][actagt a gcggccgctgca gcctt] 3'
|||| |||||| |||||||||||||||||||||||||||| |||||| | |||||||||||| |||||
3' [ggaa agatct][Rev. Comp. Seq.][< r-primer tgatca t cgccggcgacgt cggaa] 5'

2. Have the primers (oligos) synthesized (you can order through a company like www.idtdna.com).

3. Use the PCR, Clip, & Clone method with a XbaI/ PstI-digested insert (PCR fragment) and XbaI/ PstI-digested vector (e.g., V0120).