Haynes:Making BioBricks: Difference between revisions
(5 intermediate revisions by the same user not shown) | |||
Line 18: | Line 18: | ||
UPDATED: 5/19/15<br> | UPDATED: 5/19/15<br> | ||
Credit: Rene Davis (Haynes Lab) and protocol from the Zhang lab at MIT | Credit: Rene Davis (Haynes Lab) and protocol from the Zhang lab at MIT | ||
1. Design your oligos: An oligo insert should have a XbaI sticky end upstream of the part, SpeI and NotI sites downstream, and a PstI sticky end downstream. | 1. Design your oligos: An oligo insert should have a XbaI sticky end upstream of the part, SpeI and NotI sites downstream, and a PstI sticky end downstream. | ||
Line 68: | Line 69: | ||
4. Using 2.0 μL of the 1:250 diluted dsOligo per 50 - 100 ng vector works well in our hands. If you prefer to calculate the amount of insert needed to set up a specific ratio of insert to vector for the ligation, use this formula to estimate ng/μl of the oligo insert:<br> | 4. Ligate the double-stranded insert into a linearized vector with XbaI and PstI ends and transform into ''E. coli.'' (use any standard ligation/ transformation protocol)<br> | ||
Note: Using 2.0 μL of the 1:250 diluted dsOligo per 50 - 100 ng vector works well in our hands. If you prefer to calculate the amount of insert needed to set up a specific ratio of insert to vector for the ligation, use this formula to estimate ng/μl of the oligo insert:<br> | |||
[(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 / | [(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 / | ||
μl dH2O used to dissolve dry oligo 2) * 1.0 μl] / 20 μl <br> | μl dH2O used to dissolve dry oligo 2) * 1.0 μl] / 20 μl <br> | ||
</div> | </div> | ||
Line 138: | Line 137: | ||
==PCR Amplification== | ==PCR Amplification== | ||
UPDATED: 05/19/15<br> | |||
Credit: Karmella Haynes | |||
<div style="width: 800px"> | <div style="width: 800px"> | ||
Line 159: | Line 161: | ||
<div style="width: 800px"> | <div style="width: 800px"> | ||
2. Have the primers (oligos) synthesized (you can order through a company like www.idtdna.com). | 2. Have the primers (oligos) synthesized (you can order through a company like www.idtdna.com). | ||
<br> | <br> | ||
3. | 3. Use the [http://openwetware.org/wiki/Haynes:PCR_clip_clone PCR, Clip, & Clone method] with a XbaI/ PstI-digested insert (PCR fragment) and XbaI/ PstI-digested vector (''e.g.'', V0120). | ||
Latest revision as of 14:46, 19 May 2015
Making Standardized DNA Parts
Or, Less Expensive Alternatives to DNA Synthesis
- Double-stranded Oligo Insert: A part that is smaller than ~85 bp can be made into an oligonucleotide insert.
- Overlapping Oligos: A part that is between ~ 85 - 150 bp can be assembled from smaller overlapping oligonucleotides.
- PCR Amplification: For a part that is larger than ~150 bp and is based on an existing DNA fragment, use PCR amplification of the existing DNA.
Double-stranded Oligo Insert
UPDATED: 5/19/15
Credit: Rene Davis (Haynes Lab) and protocol from the Zhang lab at MIT
1. Design your oligos: An oligo insert should have a XbaI sticky end upstream of the part, SpeI and NotI sites downstream, and a PstI sticky end downstream.
Sense oligo: | 5' CTAGA[coding sequence]ACTAGTAGCGGCCGCTGCA 3' |
Anti-sense oligo: | 5' GCGGCCGCTACTAGT[reverse complement of coding sequence]T 3' |
Double stranded result:
5' ctaga [coding sequence] actagt a gcggccgctgca 3'
| ||||||||||||||||| |||||| | ||||||||
3' t [rev. comp. seq.] tgatca t cgccggcg 5'
2. Have the oligos synthesized (you can order through a company like www.idtdna.com). They do not require 5' phosphates.
3. Set up an annealing/ phosphorylation reaction as follows:
Sense oligo (100 μM) | 1.0 μl |
Anti-sense oligo (100 μM) | 1.0 μl |
10x T4 ligation Buffer (NEB) | 1.0 μl |
T4 PNK (NEB) | 0.5 μl |
dH2O | 6.5 μl |
10 μl |
Thermal cycler program:
- 37°C, 30 min
- 95°C, 5 min
- Ramp down to 25°C, 5°C/1 min. [90/1 min, 85/1 min, 80/1 min, ... 25°C/1 min]
- 25°C, ∞
Dilute the product(s) 1:250
- Add 2 μL product to 498 μL dH2O
4. Ligate the double-stranded insert into a linearized vector with XbaI and PstI ends and transform into E. coli. (use any standard ligation/ transformation protocol)
Note: Using 2.0 μL of the 1:250 diluted dsOligo per 50 - 100 ng vector works well in our hands. If you prefer to calculate the amount of insert needed to set up a specific ratio of insert to vector for the ligation, use this formula to estimate ng/μl of the oligo insert:
[(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 /
μl dH2O used to dissolve dry oligo 2) * 1.0 μl] / 20 μl
Overlapping Oligos
[Top left][ other ][ other ][Top right]
|||||||||||||||||||||||||||||||||||||||||
[Bottom left ][ other ][ Bottom right ]
Input the desired full length sequence in the large text field. Click the check box by Add BioBrick Prefix and Suffix.
Choose "Custom Prefix" and enter:
- ctaga (top strand)
- t (bottom strand)
Choose "Custom Suffix" and enter:
- actagtagcggccgctgca (top strand)
- tgatcatcgccggcg (bottom strand)
5' ctaga [Top left][ other ][ other ][Top right] actagt a gcggccgctgca 3'
| ||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||
3' t [Bottom left ][ other ][ Bottom right ] tgatca t cgccggcg 5'
3. Set up an annealing reaction as follows:
Oligo (100 μM) | 3.0 μl of each |
10x annealing buffer* | 2.0 μl |
dH2O | ____ μl |
20 μl |
Heat at 100°C for 5 min., remove the entire heat block or water bath from the heat source, and allow to cool slowly to room temperature.
--> *10x annealing buffer: 1 M NaCl; 100 mM Tris-HCl, pH 7.4
4. Use this formula to estimate ng/μl of the oligo insert:
[(total ng stock oligo 1 / μl dH2O used to dissolve dry oligo 1 + total ng stock oligo 2 / μl dH2O used to dissolve dry oligo 2 + …n) * 3 μl] / 20 μl
5. Ligate the double-stranded insert into a linearized vector with XbaI and PstI ends and transform into E. coli. (use any standard ligation/ transformation protocol)
PCR Amplification
UPDATED: 05/19/15
Credit: Karmella Haynes
1. Design your primers: For typical BioBrick construction, you want a PCR product that has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part (with extra bases at each end to aid restriction digestion).
Forward primer: | 5' CCTTTCTAGA [15-20 bp of the coding strand] 3' |
Reverse primer: | 5' AAGGCTGCAGCGGCCGCTACTAGT [15-20 bp reverse complement] 3' |
Here is what your final double stranded product will look like:
5' [cctt tctaga f-primer >][Coding sequence][actagt a gcggccgctgca gcctt] 3'
|||| |||||| |||||||||||||||||||||||||||| |||||| | |||||||||||| |||||
3' [ggaa agatct][Rev. Comp. Seq.][< r-primer tgatca t cgccggcgacgt cggaa] 5'
2. Have the primers (oligos) synthesized (you can order through a company like www.idtdna.com).
3. Use the PCR, Clip, & Clone method with a XbaI/ PstI-digested insert (PCR fragment) and XbaI/ PstI-digested vector (e.g., V0120).