Hartings AU Photosynthesis Lab:Materials/WT Sequence text

From OpenWetWare

< Hartings AU Photosynthesis Lab:Materials(Difference between revisions)
Jump to: navigation, search
Current revision (15:56, 14 January 2013) (view source)
(Removing all content from page)
 
Line 1: Line 1:
-
{{Template:Hartings AU Photosynthesis Lab}}
 
-
ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGACGTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTCAAACATCTGAAAACTGAAGCTGAAATGAAAGCTTCTGAAGATCTGAAAAAACATGGTGTTACCGTGTTAACTGCCCTAGGTGCTATCCTTAAGAAAAAAGGGCATCATGAAGCTGAGCTCAAACCGCTTGCGCAATCGCATGCTACTAAACATAAGATCCCGATCAAATACCTGGAATTCATCTCTGAAGCGATCATCCATGTTCTGCATTCTAGACATCCAGGTGACTTCGGTGCTGACGCTCAGGGTGCTATGAACAAAGCTCTCGAGCTGTTCCGTAAAGATATCGCTGCTAAGTACAAAGAACTGGGTTACCAGGGTTAATGA
 

Current revision

Personal tools