Hartings AU Photosynthesis Lab:Materials/WT Sequence text

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search

Matt Hartings (Talk | contribs)
(New page: {{Template:Hartings AU Photosynthesis Lab}} ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGAC GTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTC...)
Next diff →

Revision as of 15:49, 14 January 2013



ATGGTTCTGTCTGAAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGAC GTCGCTGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTGGAAAAATTCGATCGTTTCAAACATCTGAAAACTGAAGCTGAAATGAAAGCTTCTGAAGATCTGAAAAAACATGGTGTTACCGTGTTAACTGCCCTAGGTGCTATCCTTAAGAAAAAAGGGCATCATGAAGCTGAGCTCAAACCGCTTGCGCAATCGCATGCTACTAAACATAAGATCCCGATCAAATACCTGGAATTCATCTCTGAAGCGATCATCCATGTTCTGCATTCTAGACATCCAGGTGACTTCGGTGCTGACGCTCAGGGTGCTATGAACAAAGCTCTCGAGCTGTTCCGTAAAGATATCGCTGCTAAGTACAAAGAACTGGGTTACCAGGGTTAATGA

Personal tools