Hartings AU Photosynthesis Lab:Materials/Hemoglobin/WT Sequence text

From OpenWetWare

< Hartings AU Photosynthesis Lab:Materials | Hemoglobin(Difference between revisions)
Jump to: navigation, search
Current revision (10:28, 14 January 2013) (view source)
 
Line 1: Line 1:
{{Template:Hartings AU Photosynthesis Lab}}
{{Template:Hartings AU Photosynthesis Lab}}
<div style="margin-left: 40px; width: 750px">
<div style="margin-left: 40px; width: 750px">
-
AATNACACGAGACAACTATGCANGNATTCNNTCGTACATGCGAAGGTCGGCACTAGGAACGAGGCNAGACAGGATGGCATCGACCTTTACAAACATATGTTCNAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACNATGACCGGGAAACATTTAACGCCTACNCTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGA
+
ATGGCTAATNACACGAGACAACTATGCANGNATTCNNTCGTACATGCGAAGGTCGGCACTAGGAACGAGGCNAGACAGGATGGCATCGACCTTTACAAACATATGTTCNAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACNATGACCGGGAAACATTTAACGCCTACNCTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGA

Current revision



ATGGCTAATNACACGAGACAACTATGCANGNATTCNNTCGTACATGCGAAGGTCGGCACTAGGAACGAGGCNAGACAGGATGGCATCGACCTTTACAAACATATGTTCNAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACNATGACCGGGAAACATTTAACGCCTACNCTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGA
Personal tools