Hartings AU Photosynthesis Lab:Materials/Hemoglobin/M8SM33SM103S Sequence text

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search

Matt Hartings (Talk | contribs)
(New page: {{Template:Hartings AU Photosynthesis Lab}} AATAAAACGAGAGAACTATGCAGCAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGCATCGACCTTTACAAACATAGCTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGA...)
Next diff →

Revision as of 14:06, 14 January 2013



AATAAAACGAGAGAACTATGCAGCAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGCATCGACCTTTACAAACATAGCTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATAGCCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA

Personal tools