Hartings AU Photosynthesis Lab:Materials/Hemoglobin/K31C Sequence text

From OpenWetWare

< Hartings AU Photosynthesis Lab:Materials | Hemoglobin(Difference between revisions)
Jump to: navigation, search
(New page: ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTT...)
Current revision (11:27, 14 January 2013) (view source)
 
Line 1: Line 1:
 +
{{Template:Hartings AU Photosynthesis Lab}}
 +
ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA
ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA

Current revision



ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA

Personal tools