Hartings AU Photosynthesis Lab:Materials/Hemoglobin/K31C Sequence text

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search

Matt Hartings (Talk | contribs)
(New page: ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTT...)
Next diff →

Revision as of 10:26, 14 January 2013

ATGGCTAATAAAACGAGAGAACTATGCATGAAATCACTCGAACATGCGAAGGTCGACACTAGTAACGAGGCGAGACAGGATGGTATCGACCTTTACTGCCATATGTTCGAGAACTACCCGCCATTGAGAAAATATTTCAAGAGCCGTGAAGAGTACACCGCCGAAGACGTACAGAATGATCCATTCTTCGCTAAGCAAGGACAGAAAATTCTCTTGGCATGCCACGTTCTTTGCGCCACCTACGATGACCGGGAAACATTTAACGCCTACACTAGAGAACTACTGGATCGTCACGCGAGGGACCATGTGCATATGCCACCAGAAGTTTGGACTGACTTCTGGAAGCTCTTCGAAGAATACCTAGGCAAGAAAACGACACTCGATGAGCCCACGAAGCAAGCTTGGCATGAAATCGGCAGGGAGTTTGCGAAGGAAATCAACAAGCATGGACGATGA

Personal tools