Designing primers

From OpenWetWare

Revision as of 10:53, 20 July 2005 by Josh K. Michener (Talk | contribs)
Jump to: navigation, search

This needs more work, but wanted to get it started.

General Rules

  • Avoid runs over 3 nucleotide (AAAA)
  • 18-30bp in length. Molecular Cloning says that 5' tails do not significantly affect annealing.
  • Primer pairs should differ in length by less than 3bp.
  • 3’ end should be G or C (stronger bond)
  • Primer melting temp (Tm) should be 50-60C w/ low FIR difference (<5C, 2C better)
  • Molecular Cloning advises GC content between 40% and 60%
  • Avoid palindromes and inverted repeat sequences.
  • Avoid complementarity between members of a primer pair.
  • Check for dimer binding and hairpins in Vector NTI.
    • Want to avoid structures with ΔG < -5kcal/mol

BioBrick Primers

To BioBrick a part, the following tails should be added to your primers:

  • PREFIX Primer        cctttctagag        11 bp
  • SUFFIX Primer        tactagtagcggccgctgcagcctt        25 bp


The prefix primer adds an Xba site, and the suffix adds the entire BB suffix (Spe-Not-Pst)
Check the annealing temperature both without the tail (the first cycle or so) and with the tail (the later cycles).

Useful Primer Design Tools

Personal tools