Designing primers
From OpenWetWare
Contents |
Types of Primers
In general, primers are designed to identify specific locations within a long region of DNA, either plasmid or genomic. Primer binding sites are ideally unique within the range of DNA found in the reaction tube. Single primers are used to amplify and label DNA fragments for sequencing reactions, or as probes for Southern blots. Pairs of primers are used to delimit the range of DNA amplified during a PCR reaction. Because biological enzymes selectively add bases on the 3' end of primed double stranded DNA, the binding of the 3' end of the primer is especially important, while the 5' end of the primer can either bind or not, with relatively little effect on most uses of the primer. The binding of the 3' end is less important in the design of Southern blotting probes, as the bound primer is not extended.
Synthesis of Primers
Primers are synthesized using a multi-step anhydrous chemical process, which builds the primers from the 3' to the 5' end, the opposite from the DNA synthesis direction found in biological systems. Synthesis starts with a glass bead filled column containing a specific 3' base bound to the glass. Chemically activated nucleotides, termed phosphoramidites, are linked in 3' to 5' order to fabricate the DNA, which is then cleaved from the column using aqueous ammonia. The use of chemical synthesis provides many opportunities to build DNA fragments with unnatural bases, which can be very useful in experimental settings.
The fact that primers are synthesized 3' to 5' means that all or nearly all primers are correct and identical at the 3' end, which is important for locating the site of biological synthesis. Synthesized primers typically have a significant error rate, with most 100 bp primers being incorrect in one or more locations. The most common error is a truncation of the 5' end, followed by point deletions of single bases. Long strings of G's are problematic for synthesis.
General guidelines
- Avoid runs over 3 nucleotide (GGGG)
- Long stretches of G, in particular, give problems.
- 18-30bp in length. Molecular Cloning says that 5' tails do not significantly affect annealing.
- Primer pairs should differ in length by less than 3bp.
- 3’ end should be G or C (stronger bond)
- Primer melting temp (Tm) should be 50-60°C with low FIR difference (<5°C, <2°C better)
- Molecular Cloning advises GC content between 40% and 60%
- Avoid palindromes and inverted repeat sequences.
- Avoid complementarity between members of a primer pair.
- Check for dimer binding and hairpins in Vector NTI.
- Want to avoid structures with ΔG < -5kcal/mol
- Long primers (those approximately >50 bp or those needed for sensitive applications) should be purified. Note that the purification step costs extra. See the Invitrogen FAQ on purification options for more information on which purification method to choose.
- Verify that your primers are designed and ordered in the correct orientation (oligos are always specified 5' to 3', left to right).
- If you plan to cut your PCR product near the ends of the linear DNA fragment, note that some enzymes do not cut efficiently at the ends of linear DNA. So include extra bases to increase the efficiency of cutting. Many enzymes work with 4 bases supposedly but XhoI was found to require more than 4 bases (8 bases was used successfully). Thus, to be on the safe side, use 8 bases whenever possible. NEB has more information here. Read the information at NEB carefully ... they recommend adding 4 bases to the numbers listed in their table.
- Tom's rule of thumb is that if a PCR fails, try it again. The second time around, work a bit harder by varying the annealing temperature or something else. If it fails again, redesign your primers.
BioBrick primers
To BioBrick a part, the following tails should be added to your primers:
- PREFIX Primer cctttctagag 11 bp
- SUFFIX Primer tactagtagcggccgctgcagcctt 25 bp
The prefix primer adds an Xba I site, and the suffix adds the entire BB suffix (Spe I-Not I-Pst I)
Check the annealing temperature both without the tail (the first cycle or so) and with the tail (the later cycles).
Resources
Useful primer design tools
- Austin's clipboard tool - online tool for generating the complement, reverse complement and restriction enzyme site analysis of a DNA sequence. It also translates the sequence and gives the amino acids properties.
- IDT Oligo Analyzer - A relatively complete suite of online tools for primer analysis.
- Invitrogen
- List of Primer Design Software
- Perlprimer - Open-source, cross-platform PCR primer design software
- Primer3
- PrimerX - This is a useful online tool for designing primers for site directed mutagenesis.
- VectorNTI


