Designing primers

This needs more work, but wanted to get it started.

General Rules

• Avoid runs over 3 nucleotide (AAAA)
• 18-30bp in length. Molecular Cloning says that 5' tails do not significantly affect annealing.
• Primer pairs should differ in length by less than 3bp.
• 3’ end should be G or C (stronger bond)
• Primer melting temp (Tm) should be 50-60C w/ low FIR difference (<5C, 2C better)
• Molecular Cloning advises GC content between 40% and 60%
• Avoid palindromes and inverted repeat sequences.
• Avoid complementarity between members of a primer pair.
• Check for dimer binding and hairpins in Vector NTI.
  • Want to avoid structures with ΔG < -5kcal/mol

BioBrick Primers

To BioBrick a part, the following tails should be added to your primers:

• PREFIX Primer        cctttctagag        11 bp
• SUFFIX Primer        tactagtagcggccgctgcagcctt        25 bp

The prefix primer adds an Xba site, and the suffix adds the entire BB suffix (Spe-Not-Pst)
Check the annealing temperature both without the tail (the first cycle or so) and with the tail (the later cycles).

Useful Primer Design Tools

• Austin's clipboard tool - online tool for generating the complement, reverse complement and restriction enzyme site analysis of a DNA sequence. It also translates the sequence and gives the amino acids properties.
• Oligo Analyzer - A relatively complete suite of online tools for primer analysis.
• Invitrogen
• List of Primer Design Software
• Primer3
• PrimerX - This is a useful online tool for designing primers for site directed mutagenesis.
• VectorNTI