Designing primers: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
Barry Canton (talk | contribs) |
||
Line 31: | Line 31: | ||
*[https://catalog.invitrogen.com/index.cfm Invitrogen] | *[https://catalog.invitrogen.com/index.cfm Invitrogen] | ||
*[http://www.bioinformatics.vg/biolinks/bioinformatics/verbose/PCR%2520and%2520Primer%2520Design.shtml List of Primer Design Software] | *[http://www.bioinformatics.vg/biolinks/bioinformatics/verbose/PCR%2520and%2520Primer%2520Design.shtml List of Primer Design Software] | ||
*[http://perlprimer.sourceforge.net/ Perlprimer] - Open-source, cross-platform PCR primer design software | |||
*[http://frodo.wi.mit.edu/primer3/primer3_code.html Primer3] | *[http://frodo.wi.mit.edu/primer3/primer3_code.html Primer3] | ||
*[http://bioinformatics.org/primerx/index.htm PrimerX] - This is a useful online tool for designing primers for site directed mutagenesis. | *[http://bioinformatics.org/primerx/index.htm PrimerX] - This is a useful online tool for designing primers for site directed mutagenesis. |
Revision as of 09:07, 24 August 2005
General guidelines
- Avoid runs over 3 nucleotide (AAAA)
- 18-30bp in length. Molecular Cloning says that 5' tails do not significantly affect annealing.
- Primer pairs should differ in length by less than 3bp.
- 3’ end should be G or C (stronger bond)
- Primer melting temp (Tm) should be 50-60°C with low FIR difference (<5°C, <2°C better)
- Molecular Cloning advises GC content between 40% and 60%
- Avoid palindromes and inverted repeat sequences.
- Avoid complementarity between members of a primer pair.
- Check for dimer binding and hairpins in Vector NTI.
- Want to avoid structures with ΔG < -5kcal/mol
- Long primers (those approximately >50 bp or those needed for sensitive applications) should be purified. Note that the purification step costs extra. See the Invitrogen FAQ on purification options for more information on which purification method to choose.
- Verify that your primers are designed and ordered in the correct orientation (oligos are always specified 5' to 3', left to right).
- If you plan to cut your PCR product near the ends of the linear DNA fragment, note that some enzymes do not cut efficiently at the ends of linear DNA. So include extra bases to increase the efficiency of cutting. Many enzymes work with 4 bases supposedly but XhoI was found to require more than 4 bases (8 bases was used successfully). Thus, to be on the safe side, use 8 bases whenever possible. NEB has more information here. Read the information at NEB carefully ... they recommend adding 4 bases to the numbers listed in their table.
- Tom's rule of thumb is that if a PCR fails, try it again. The second time around, work a bit harder by varying the annealing temperature or something else. If it fails again, redesign your primers.
BioBrick primers
To BioBrick a part, the following tails should be added to your primers:
- PREFIX Primer cctttctagag 11 bp
- SUFFIX Primer tactagtagcggccgctgcagcctt 25 bp
The prefix primer adds an Xba I site, and the suffix adds the entire BB suffix (Spe I-Not I-Pst I)
Check the annealing temperature both without the tail (the first cycle or so) and with the tail (the later cycles).
Resources
Useful primer design tools
- Austin's clipboard tool - online tool for generating the complement, reverse complement and restriction enzyme site analysis of a DNA sequence. It also translates the sequence and gives the amino acids properties.
- IDT Oligo Analyzer - A relatively complete suite of online tools for primer analysis.
- Invitrogen
- List of Primer Design Software
- Perlprimer - Open-source, cross-platform PCR primer design software
- Primer3
- PrimerX - This is a useful online tool for designing primers for site directed mutagenesis.
- VectorNTI