Colony-screening PCR

Colony PCR

We should have assembled our promoter (from the RNR3 gene), the gene (GFP), and the vector together into one DNA construct which was transformed into bacterial cells to produce colonies. While each colony ought to have the correct DNA construct, both the assembly process and the process of polymerase cycling assembly (templateless and finish PCR) that we used to create the GFP gene are not perfect and do, in fact, produce many smaller DNA fragments. We therefore always need to screen the bacterial colonies to verify that they contain a correct DNA construct.
Colonies are checked first by colony PCR, which verifies the size of the gene, and then by DNA sequencing, which verifies that there are no mutations in the DNA sequence. When screening, we want to start with several clones to maximize the likelihood that we have at least one clone that is correct. We will therefore be setting up 6 PCR reactions (4 different DNA clones (bacterial colonies) plus positive and negative controls. Colony PCR is a commonly used method to quickly screen plasmids containing a desired insert directly from bacterial colonies. This method eliminates the need to first purify the plasmid DNA for use as a template for PCR.

Reaction Setup:

1. Transfer 94 ul of 2X master Mix into a large microcentrifuge tube. Keep on ice at all times!

2. Add 3.8 ul of primer mix to the same microcentrifuge tube.

3. Add 90 ul of sterile water to the same microcentrifuge tube. Pipet up and down 10X to completely mix the contents of the tube.

4. Aliquot (distribute) 25 ul per tube of the mix into 6 PCR tubes (the very small ones).

5. Obtain one LB+Amp plate and label the back side of the plate with the numbers 1-4, your initials, and the date.

6. Use a sterile toothpick to pick up one individual colony from your bacterial plate from last week. Dip the sterile toothpick into one of the PCR tubes. As soon as the solution looks cloudy, remove the toothpick. Using the same toothpick, streak the toothpick onto the new labeled LB+Amp plate at position #1.

7. Repeat step #6 for colonies #2-4.

8. Into PCR tube #5, add 1 ul from tube PC. Into PCR tube #6, add 1 ul of sterile water.

9. Put your 6 PCR tubes into one row of the PCR machine and begin the PCR reaction.

Reaction Conditions:

1 cycle:
        94°C, 2 minutes
30 cycles:
       	94oC, 30 seconds
       	55oC, 30 seconds
       	68oC, 1 minute
1 cycle:
        68oC, 10 minutes

10. Parafilm your bacterial plates from last week and store in the fridge until we analyze the PCR reactions. Place your new plate of bacteria (#1-6) into the 37C incubator (remember to place the plate upside down). If the PCR reactions indicate that we have an insert of the correct size, we can come back to these cultures to regrow the bacterial cells with the plasmid to send the plasmid for DNA sequencing.

Gel Electrophoresis

Pouring a Gel:

1. Weigh out 0.5 g of agarose on a piece of weigh paper. Transfer to an Erlenmeyer flask. Add 50 ml of 1X TAE.
2. Place the flask in the microwave and heat until the agarose is completely transparent and colorless.
3. Allow the agarose to cool -this will take about 10 min.
4. While the agarose is cooling, place the gel tray into the gel box and add the comb.
5. When the agarose is cool, add 1 ul of Gel Red to the melted agarose.
6. Swirl the agarose to incorporate the Gel Red and pour the agarose into the gel tray.
7. Allow the gel to solidify for 15-20 minutes. During this time, you prepare your samples (below).

Preparing your samples:

1. Gather your colony screening PCR products. They should be:

1. Colony 1
2. Colony 2
3. Colony 3
4. Colony 4
5. Positive control
6. Negative control

2. To each tube, add 5 ul of 6X DNA loading dye.

Running a Gel:

1. Into lanes 1-6, load 11 ul of each of your PCR products (mixed with water and dye).
2. Into lane 7, load 5 ul of the DNA ladder (premixed with water and dye)
3. Place the lid with electrodes onto the gel box, and set voltage to 100V.
4. Run gel approximately 30 minutes or until the dye is 2/3 of the way down the gel, then take a picture.
5. When done, you want to check that:

• There are no DNA bands in the NC lane of the gel (lane 6)
• There is a DNA band in the PC lane of the gel (lane 5). This should be ~750 base pairs in length.
• The colony screening PCR products (lanes 1-4) are full-length. A full-length product should give a band of ~1500 bp.

DNA Sequencing

Once we’ve screened our clones by colony-screening PCR to verify that they contain an insert of the correct size, we need to sequence the inserts to verify that they contain a GFP gene and an RNR3 promoter without any sequence errors.

Sanger sequencing:

The DNA is sequenced using chain termination sequencing (also called Sanger or cycle sequencing). Information on cycle sequencing and how it works can be found here: [1] and [2].

When sequencing data is sent to us, we receive not only a text file containing the sequence of the DNA insert, but we also receive the data from the sequencing machine in the form of a color-coded electropherogram. The electopherogram represents the data obtained from sequencing detector, with the height of each peak representing the strength of the signal. We can therefore see the quality of the sequencing data that was obtained as well as investigate any ambiguities in the sequence. A sample electropherogram is here: [3]

You will notice that the signal at the end of the electropherogram is not as strong as at the beginning; the peaks are much shorter and broader and become difficult to distinguish from one another. This is due to the difficulty of discriminating between relatively long DNA sequences at single-nucleotide resolution. Our GFP gene is about 750 bp long. However, DNA sequencing reactions (called sequencing "reads") are only 700 nucleotides long. We therefore sequence each clone twice (once from the beginning to the end of the GFP gene and once from the end to the beginning)- we call these "forward” and “reverse” sequencing reads. This ensures that we will get good sequencing data across the entire gene.

Comparing the forward sequencing read to the desired GFP sequence:

Now we need to determine if our clones contain a sequence that perfectly matches the GFP gene and promoter or if they have DNA sequence errors. To accomplish this, we a bioinformatics tool called ClustalW: [4].
1. Under "Step 1" of ClustalW, change the settings from Protein to DNA.
2. Input the sequence of the GFP gene. The line before the GFP sequence must contain >GFP (no spaces).

>GFP
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC CCGTGCCCTGGCCCACCCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGAC CCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAG GTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATC ACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA 

3. Skip a line and input the forward sequencing reaction:

>GFP.forward
TAGCGAGCTAGGATTTTTTTTATCTGAATTCTGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTCGAGTTGATCGGGCACGTAAGAGGTTCCAACTTTCACCATAATGAAAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGAATCCAAGCCTCGAGCTGTCAGACCAAGTTTACTCATA 

4. Click Align.

Clustal W gives you a scores table indicating the pairwise alignment similarity score (out of 100). More importantly, it provides a DNA alignment. Residues that are identical in the two sequences marked with a *. The alignment extends past the end of the GFP gene and continues to sequence the vector as well.

Analyzing the reverse sequencing read:

The reverse sequencing read is the reverse complement of the GFP sequence because it sequenced the complementary DNA strand of the double helix. To line it up with the GFP gene, we must first reverse the sequence.
5. Go to the Sequence Manipulation Suite: [5]

6. Make sure that you are on the Reverse Complement page and input your reverse sequencing read.

>GFP.reverse
AGTAATCTTTTCGGTTTTAAAGAAAAAGGGCAGGTTACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGGTCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCGGTGATATAGACCTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGGCGAAGCACTGCACGCCGTAGGTCAAGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATTTTAATTTAAAAGGATCTAGGTGAAGATCCTTT 

7. Click Submit.
8. Cut and paste the resulting sequence into Clustal W.

The result should show the GFP gene aligned with both the forward and reverse sequencing reads. At any nucleotide position, if your forward and reverse reads do not agree, one of the sequences is probably HIGHER quality than the other at every individual discrepant base (it’s more likely the ends at the beginning of the sequencing read are more reliable than at the end of the sequencing read. A mutation is only recorded if the forward and reverse reads agree with each other and disagree with the building block sequence.

Analyzing sequencing reads that contain a mutation:

The two sequences below contain a mutation in the GFP gene.

9. Repeat steps 1-8 above to identify mutation(s) in these sequences.

>GFP.forward.with.mutation
TAGCGAGCTAGGATTTTTTTTATCTGAATTCTGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTCGAGTTGATCGGGCACGTAAGAGGTTCCAACTTTCACCATAATGAAAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGAATCCAAGCCTCGAGCTGTCAGACCAAGTTTACTCATA 

>GFP.reverse.with.mutation
AAAGGATCTTCACCTAGATCCTTTTAAATTAAAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGATCACTCTCGGCATGGACGAGCTGTACAAGTAACCTGCCCTTTTTCTTTAAAACCGAAAAGATTACT