Biomod/2014/ASU/Materials: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(33 intermediate revisions by the same user not shown)
Line 145: Line 145:


h1, h2, #super-list, .box, .tagline, #index-list {
h1, h2, #super-list, .box, .tagline, #index-list {
   font-family: 'Lato', 'Helvetica Neue', Arial, sans-serif;
   font-family: Times New Roman;
  font-size: 18px;
  color: #000000;
}
}


Line 293: Line 295:
.box.b1x2{
.box.b1x2{
width: 930px;
width: 930px;
         height: 1500px;
         height: 3500px;
}
.box.b1x2 > img
{
display: block;
}
}
.box.b1x3{
.box.b1x3{
width: 700px;
width: 700px;
Line 1,566: Line 1,571:
                                 </ul></li>
                                 </ul></li>
                         <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Results"><i class="menu-icon icon-studio"></i><span>Results</span></a></li>
                         <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Results"><i class="menu-icon icon-studio"></i><span>Results</span></a></li>
                        <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Discussion"><i class="menu-icon icon-studio"></i><span>Discussion</span></a></li>
<li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Team"><i class="menu-icon icon-studio"></i><span>Team</span></a></li>
<li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Team"><i class="menu-icon icon-studio"></i><span>Team</span></a></li>
                         <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Acknowledgement"><i class="menu-icon icon-studio"></i><span>Acknowledgements</span></a></li>
                         <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Acknowledgement"><i class="menu-icon icon-studio"></i><span>Acknowledgements</span></a></li>
Line 1,582: Line 1,588:
<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Tile Assembly</span></p>
<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Tile Assembly</span></p>
                       <hr>
                       <hr>
<p style = "color: #000000; font-size: 16px;"><b>· buffer stock (10x TAE/Mg2+)</b></p>
<p style = "color: #000000; font-size: 16px;"><b>· ssDNA strand stocks</b></p><br>
<img src = "http://openwetware.org/images/0/05/Screen_Shot_2014-10-25_at_10.18.42_PM.png">
<img src = "http://openwetware.org/images/9/9f/Screen_Shot_2014-10-25_at_10.19.40_PM.png">
<img src = "http://openwetware.org/images/a/ae/Screen_Shot_2014-10-25_at_10.20.50_PM.png">
<img src = "http://openwetware.org/images/1/19/Screen_Shot_2014-10-25_at_10.21.48_PM.png">
<br>
<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Gel Electrophoresis (PAGE)</span></p>
                      <hr>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· 40% acrylamide</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· water</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· 10x TAE/Mg2+ + 1M KCl buffer</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Ammonium persulfate (APS)</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Tetramethylethylenediamine (TEMED)</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· SYBR Green gel stain</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Native dye</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; - 0.2% bromophenol blue</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; - 0.2% xylene cyanole</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; - 5% glycerol</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; - in 1x TAE/Mg2+ buffered solution</p><br>


<p style = "color: #000000; font-size: 16px;>--buffer stock (10x TAE/Mg2+)</p>
 
<p style = "color: #000000; font-size: 16px;>--ssDNA strand stocks (need to put in sequence)</p>
<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Gel electrophoresis (Agarose)</span></p>
<p style = "color: #000000; font-size: 16px;font:"Courier New", Courier, monospace;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;BT1, CCGGTGGTAAGGTCCGTATGTTAACCGCAGGACCTACA</p>
                      <hr>
                        
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Agarose powder</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· water</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· SYBR Safe</p><br>
 
 
<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">PCR</span></p>
                      <hr>
<p style = "color: #000000; font-size: 16px;text-decoration:underline;">New England Biolabs PCR kit:</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Phusion High-Fidelity DNA polymerase</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· 10 mM dNTPs</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· DMSO</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· 5x Phusion buffer</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Affinity column preparations:</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· NHS ester beads</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· PCR Buffer</p><br>
<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Affinity Column Preparation</span></p>
                      <hr>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· NHS modified agarose beads</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Coupling buffer: HEPES 100 mM, pH 7.2, 150 mM NaCl</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Quenching buffer: 1 M Tris, pH 7.4</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Binding buffer: 1x TAE Mg2+, 100 mM KCl</p><br>
<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Computer Simulation</span></p>
                       <hr>         
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· CaDNAno</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Cando</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· PyMol</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Chimera</p>
<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Avogadro</p><br>
                  
                  
</div>
</div>

Latest revision as of 23:22, 25 October 2014

<html xmlns="http://www.w3.org/1999/xhtml" xmlns:v="urn:schemas-microsoft-com:vml" xml:lang="en" lang="en" dir="ltr"> <head>

<title>Nanodevils - OpenWetWare</title> <style type="text/css" media="screen, projection">/*<![CDATA[*/ @import "/skins/common/shared.css?164"; @import "/skins/monobook/main.css?164"; /*]]>*/</style> <link rel="stylesheet" type="text/css" media="print" href="/skins/common/commonPrint.css?164" /> <!--[if lt IE 5.5000]><style type="text/css">@import "/skins/monobook/IE50Fixes.css?164";</style><![endif]--> <!--[if IE 5.5000]><style type="text/css">@import "/skins/monobook/IE55Fixes.css?164";</style><![endif]--> <!--[if IE 6]><style type="text/css">@import "/skins/monobook/IE60Fixes.css?164";</style><![endif]--> <!--[if IE 7]><style type="text/css">@import "/skins/monobook/IE70Fixes.css?164";</style><![endif]--> <!--[if lt IE 7]><script type="text/javascript" src="/skins/common/IEFixes.js?164"></script> <meta http-equiv="imagetoolbar" content="no" /><![endif]-->

<script type= "text/javascript">/*<![CDATA[*/ var skin = "monobook"; var stylepath = "/skins"; var wgArticlePath = "/wiki/$1"; var wgScriptPath = ""; var wgScript = "/index.php"; var wgVariantArticlePath = false; var wgActionPaths = []; var wgServer = "http://openwetware.org"; var wgCanonicalNamespace = ""; var wgCanonicalSpecialPageName = false; var wgNamespaceNumber = 0; var wgPageName = "Biomod/2014/ASU"; var wgTitle = "Biomod/2014/ASU"; var wgAction = "view"; var wgArticleId = "136275"; var wgIsArticle = true; var wgUserName = null; var wgUserGroups = null; var wgUserLanguage = "en"; var wgContentLanguage = "en"; var wgBreakFrames = false; var wgCurRevisionId = "750826"; var wgVersion = "1.13.2"; var wgEnableAPI = true; var wgEnableWriteAPI = false; var wgMWSuggestTemplate = "http://openwetware.org/api.php?action=opensearch\x26search={searchTerms}\x26namespace={namespaces}"; var wgDBname = "owwdb"; var wgSearchNamespaces = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 100, 101, 110, 111]; var wgMWSuggestMessages = ["with suggestions", "no suggestions"]; var wgRestrictionEdit = []; var wgRestrictionMove = []; /*]]>*/</script>

<script type="text/javascript" src="/skins/common/wikibits.js?164"><!-- wikibits js --></script> <!-- Head Scripts --> <script type="text/javascript" src="/skins/common/ajax.js?164"></script> <script type="text/javascript" src="/ext/AjaxShowEditors/AjaxShowEditors.js"></script> <script type="text/javascript" src="/skins/common/mwsuggest.js?164"></script> <script type="text/javascript" src="/index.php?title=-&amp;action=raw&amp;gen=js&amp;useskin=monobook"><!-- site js --></script> <style type="text/css">/*<![CDATA[*/ @import "/index.php?title=MediaWiki:Common.css&usemsgcache=yes&action=raw&ctype=text/css&smaxage=18000"; @import "/index.php?title=MediaWiki:Monobook.css&usemsgcache=yes&action=raw&ctype=text/css&smaxage=18000"; @import "/index.php?title=-&action=raw&gen=css&maxage=18000&useskin=monobook"; /*]]>*/</style> </head> <body class="mediawiki ns-0 ltr page-Biomod_2014_ASU"> <div id="globalWrapper"> <div id="column-content"> <div id="content"> <a name="top" id="top"></a> <h1 class="firstHeading">Biomod/2014/ASU</h1> <div id="bodyContent"> <h3 id="siteSub">From OpenWetWare</h3> <div id="contentSub"><span class="subpages">&lt; <a href="/wiki/Biomod" title="Biomod">Biomod</a> | <a href="/wiki/Biomod/2014" title="Biomod/2014">2014</a></span></div> <div id="jump-to-nav">Jump to: <a href="#column-one">navigation</a>, <a href="#searchInput">search</a></div> <!-- start content --> <p>

<link rel="stylesheet" href="http://fonts.googleapis.com/css?family=Lato:300,100&amp;subset=latin"> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.2/jquery.min.js" ></script>

<script type"text/javascript"> $(function () { $("style[media*='screen']").remove(); $("link[href*='favicon']").remove(); //fix heading var h1 = $(".firstHeading").text().split("/"); $(".firstHeading").text(h1[h1.length-1]); $("tr:odd").addClass("odd"); }); </script>

<style type="text/css"> /**** Base styles ****/

  1. column-one, #footer, div#sidebar-main, #contentSub, .firstHeading, #siteSub, #jump-to-nav, .printfooter{
   display: none;
 

}

  1. content {
   margin: 0;
   padding: 0;

background: #fff; border: none; }


html, body, div, span, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, abbr, address, cite, code, del, dfn, em, img, ins, kbd, q, samp, small, strong, sub, sup, var, b, i, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, figcaption, figure, footer, header, hgroup, menu, nav, section, summary, time, mark, audio, video {

 margin: 0;
 padding: 0;
 border: 0;
 font: inherit;
 

}

article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section {

 display: block;

}

body {

 /*padding: 15px;*/
 font-family: 'Lato', 'Lucida Sans Regular', 'Lucida Grande', 'Lucida Sans Unicode', Arial, sans-serif;
 font-size: 2rem;
 font-weight: 200;
 line-height: 1.4;
 background: #fff;
 color: #000000;
 max-width: 1280px;
 padding-top: 55px;
margin-left: auto;
   margin-right: auto;

} } h1, h2, h3, p, ul, ol, pre, dl {

 font-weight: 100;

}

h1, h2, #super-list, .box, .tagline, #index-list {

 font-family: Times New Roman;
 font-size: 18px;
 color: #000000;

}

h1, h2, h3 { font-weight: 300; }

h1 {

 font-size: 16px;
 line-height: 1.1em;

}

h2 {

 font-size: 22px;
 

}


a, a code {

 color: #FB4;
 text-decoration: none;

}

a:hover, a:hover code {

 color: #FFCC00; 

}

a:active, a:active code {

 color: #000000;
 /*background: black;*/

}

a img { border: none; }

a.anchor{display: block; position: relative; visibility: hidden;}

p{ text-align:left; }

em { color: #00EF00; } strong { font-weight: bold; }

blockquote {

 padding-left: 1.0em;
 margin-left: 1.0em;
 border-left: 1px solid #333;
 font-style: italic;

}


nav {

 background: rgba(25, 25, 25, 0.85);
 padding: 0px;
 position: fixed;
 top: 0px;
 left: 0px;
bottom: 0px;
 right: 0px;
 z-index: 100;

}

nav ul {

 width: 100%;
 
 margin: 0px auto;
 padding: 0px;
 list-style-type: none;

} nav ul li {

 float: left;
 line-height:2.5;

} nav ul li.selected {

 border-bottom: solid 10px #580000;

}

nav ul li.home {

 padding: 0px;

}

nav ul a {

 float: left;
 text-decoration: none;
 color: #F2F2F2;
 text-transform: uppercase;
 font-size: 20px;
 font-weight: 300;
 padding: 0px 20px 0;

}


  1. content {
   margin-top: 60px;

}

  1. filters > li{

margin: 0px; display: inline-block; }

.box.clickable:hover{ background: none repeat scroll 0 0 #fff; }

.clickable img { transition: 0.3s ease; }

.clickable img:hover { opacity:0.9; transition: 0.3s ease; }

.background { left: 0;

   margin: 0;
   max-width: 100%;
   padding: 0;
   

} /*the boxes*/

.box.b2x2{ height: 300px; width: 300px;

       position: fixed;

} .box.b2x2 > img{ display: block;

   margin-left: auto;
   margin-right: auto;
   margin-top: 10px;
   height: 300px;
   width: 300px;
   position: fixed;

}

.box.b2x1{ height: 360px; }

.box.b1x2{ width: 930px;

       height: 3500px;

} .box.b1x2 > img { display: block; } .box.b1x3{ width: 700px; }


/*start page*/

.box.intro { font-size:7.2rem;}

.box > p { font-size: 16px;

   padding: 0 20px;
   margin-top: 10px;
   text-align: justify;

font-weight: 300; }

.box > h2 { font-size: 20px;

   font-weight: 100;

text-align:left; margin-left: 20px;

   margin-top: 15px;

}

.tease > h2 {

   font-size: 40px;
   font-weight: 100;
   margin-top: 80px;
   

}


/*project*/

.project{ background-attachment: fixed;

   width: 100%;

padding-bottom: 40px; }

.project h2 { color: #FFFFFF;

   font-weight: 300;
   margin-bottom: 30px;
   margin-left: 180px;
   padding-top: 20px;
   position: relative;

}


.project h3 {

   font-size: 26px;

}

.project .box { margin-bottom: 20px;

   margin-top: 0;

}

.interlude{ background: none repeat scroll 0 0 #2A2A2A; box-shadow: 0 0 25px rgba(0, 0, 0, 0.8); border: 1px solid rgba(0, 0, 0, 0.3);

   height: 150px;
   position: relative;
   z-index: 3;

}

.interlude *{ float:left; }

.interlude h2{ color: #FFFFFF;

   display: block;
   font-weight: 300;
   line-height: 150px;
   margin-left: 24%;
   margin-right: -14%;
   width: 50%;

}

.interlude img{ float: left;

   line-height: 150px;
   margin-left: 10%;
   margin-top: 25px;
   vertical-align: middle;

}


.clear{ clear: both; }


.project_box{ background: none repeat scroll 0 0 #FFFFFF;

   color: #000000;
   display: block;
   float: left;
   font-size: 18px;
   font-weight: 300;
   line-height: 1.6;
   margin-left: auto;
   margin-right: auto;
   overflow: hidden;
   padding: 10px;
   width: 50%;

}

.figure_box{

   display: block;
   float: left;
   margin-left: 20px;
   overflow: hidden;
   width: 230px;

}


/*se*/

.project_box h2{ color: #1A1A1A;

   display: block;
   font-weight: 300;
   margin-left: 0%;
   margin-right: -10%;
   width: 90%;

}

.project_box p{

   text-align: justify;

margin-bottom: 18px; }

.project_box li { margin-left:50px }

  1. pb_mot.project_box{

height: 350px; }

  1. pb_dna_scaff.project_box{

height: 400px; }

  1. pb_dna_req.project_box{

height: 250px; }

  1. pb_poly_intro.project_box{

/*right: -20%;*/ height: 200px;

}

  1. pb_poly_pmoxa.project_box{

/*right: -20%;*/ height: 600px; width: 1000px; overflow:scroll; }

  1. pb_ir.project_box{

/*right: -20%;*/ height: 1300px; }

  1. pb_poly_cp.project_box{

/*right: -20%;*/ height: 600px; }

/*team page*/ .bio_box {

   background: none repeat scroll 0 0 #E74C3C;
   float: left;
   font-size: 15px;
   height: 440px;
   padding: 15px;
   text-align: justify;
   width: 210px;

}

.bio_box > .name{ font-size: 24px;

   font-weight: 300;
   margin-bottom: 25px;
   text-align: center;
   width: 100%;

}

.bio_box > p{

   text-align: justify;

font-weight: 300; font-size: 16px; } .box.big img{

   opacity:1;

}

.flag > *{ float:left; } .flag > p{ font-size: 18px;

   position: relative;
   text-align: center;
   top: -6px;
   width: 75%;

margin-bottom: 10px; }

  1. team .big{

opacity:1; }

.head{ width:220px; float:left; }

/*sponsor page*/

  1. sponsors .box {
   background: none repeat scroll 0 0 white;

}


  1. sponsors figcaption {
   height: 65px;
   width: 100%;

font-size: 15px;

   font-weight: 300;
   top: auto;
   bottom: 0;
   opacity: 0;
   transform: translateY(100%);

transition: transform 0.4s, opacity 0.1s 0.3s; -webkit-transform: translateY(100%);

   -webkit-transition: -webkit-transform 0.4s, opacity 0.1s 0.3s;

}

  1. sponsors .descr{

background: none repeat scroll 0 0 rgba(0, 0, 0, 0.4);

   font-size: 12px;
   font-weight: 300;
   height: 60px;

margin: 0;

   padding-left: 10px;
   padding-right: 10px;
   padding-top: 10px;
   text-align: justify;
   top: -155px;
   line-height: 1.3;

}

  1. sponsors .descr p{

width:90%; margin-left:auto; margin-right:auto; }

  1. sponsors figure.clickable:hover figcaption{
   opacity: 1;
   transform: translateY(0px);
   transition: transform 0.4s, opacity 0.1s;

-webkit-transform: translateY(0px);

   -webkit-transition: -webkit-transform 0.4s, opacity 0.1s;

}

  1. sponsors figure:hover .descr{
   opacity: 1;
   transform: translateY(155px);
   transition: transform 0.4s, opacity 0.1s;

-webkit-transform: translateY(155px); -webkit-transition: -webkit-transform 0.4s, opacity 0.1s; }

/*gallery*/

  1. gallery .box img{

min-height: 220px;

   min-width: 220px;

} /*ptocols*/ .protocol_box{ background: none repeat scroll 0 0 #FFFFFF;

   color: #000000;
   display: block;
   float: left;
   font-size: 18px;
   font-weight: 300;
   line-height: 1.6;
   margin-left: 40px;
   margin-right: auto;
   overflow: hidden;
   padding: 10px;
   width: 66%;

} .protocol_box li { margin-left:50px }

.protocol_box p{

   text-align: justify;

margin-top: 18px; }

.protocol_box h1 { font-size: 30px; }

.protocol_box h2 { font-size: 24px; }

.protocol_box h3 { font-size: 22px; }

/*Outreach*/

.outreach_box{ background: none repeat scroll 0 0 #FFFFFF;

   color: #000000;
   display: block;
   float: left;
   font-size: 18px;
   font-weight: 300;
   line-height: 1.6;
   margin-left: 10px;
   margin-right: auto;
   overflow: hidden;
   padding: 10px;
   width: 70%;

}

.outreach_box li { margin-left:50px }


/*Acknowlegement*/

.ack_box{ background: none repeat scroll 0 0 #FFFFFF;

   color: #000000;

text-align: center;

   display: block;
   float: left;
   font-size: 18px;
   font-weight: 300;
   line-height: 1.6;
   margin-left: 10px;
   margin-right: auto;
   overflow: hidden;
   padding: 10px;
   width: 80%;

} .ack_box p { text-align: center; } .next, .prev{ z-index: 99; background-image: url("http://openwetware.org/images/5/55/Fancybox_sprite.png"); width: 36px; height: 36px; top: 200px; }


figure.box > .next { left: 425px; background-position: 0 -72px; }

figure.box > .prev { background-position: 0 -36px; }

/**** Isotope styles ****/

/* required for containers to inherit vertical size from window */ html, body {

 height: 100%;

}

  1. container {
 padding: 0px;
 bottom-margin: 10px;

}

.box {

 width: 220px;
 height: 220px;
 margin: 10px;
 float: left;
 overflow: hidden;
 position: fixed;
 background: #fff;
 color: #000000;
 display: table-cell;
 text-align: center;
 vertical-align: middle;
 overflow:hidden;

} div#b2x2{ position:fixed;} figure.box > *{ left: 0;

   position: absolute;
   right: 0;

}

.box figure{ overflow: hidden; }

.box figcaption {

   background: none repeat scroll 0 0 rgba(0, 0, 0, 0.4);
   bottom: 0;
   font-size: 20px;

font-weight: 300;

   padding-left: 5px;
   text-align: center;
   width: 100%;

z-index: 4; }

.clickable .box:hover {

 cursor: pointer;

}

/* The Magnificent Clearfix: nicolasgallagher.com/micro-clearfix-hack/ */ .clearfix:before, .clearfix:after { content: ""; display: table; } .clearfix:after { clear: both; } .clearfix { zoom: 1; }

/* Start: Recommended Isotope styles */

/**** Isotope Filtering ****/

.isotope-item {

 z-index: 2;

}

.isotope-hidden.isotope-item {

 pointer-events: none;
 z-index: 1;

}

/**** Isotope CSS3 transitions ****/

.isotope, .isotope .isotope-item {

 -webkit-transition-duration: 0.8s;
    -moz-transition-duration: 0.8s;
     -ms-transition-duration: 0.8s;
      -o-transition-duration: 0.8s;
         transition-duration: 0.8s;

}

.isotope {

 -webkit-transition-property: height, width;
    -moz-transition-property: height, width;
     -ms-transition-property: height, width;
      -o-transition-property: height, width;
         transition-property: height, width;

}

.isotope .isotope-item {

 -webkit-transition-property: -webkit-transform, opacity;
    -moz-transition-property:    -moz-transform, opacity;
     -ms-transition-property:     -ms-transform, opacity;
      -o-transition-property:      -o-transform, opacity;
         transition-property:         transform, opacity;

} .rs-wrap:after, .rs-slider:after, .rs-thumb-wrap:after, .rs-arrows:after, .rs-caption:after {

   content: ".";
   display: block;
   height: 0;
   clear: both;
   line-height: 0;
   visibility: hidden;

}

/* ===[ Slider ]=== */

.rs-wrap {

   position: relative;
   max-width: 100%;

}

.rs-slide-bg { *zoom: 1 }

.rs-slider > li > a { display: block }

.rs-slider > li {

   list-style: none;
   filter: alpha(opacity=0);
   opacity: 0;
   width: 100%;
   height: 100%;
   margin: 0 -100% 0 0;
   padding: 0;
   float: left;
   position: relative;

}

   .rs-slider > li > a {
       padding: 0;
       background: none;
       -webkit-border-radius: 0;
       -moz-border-radius: 0;
       border-radius: 0;
   }
   .rs-slider > li img {
       display: block;
       max-width: 100%;
       max-height: 100%;
       -ms-interpolation-mode: bicubic;
   }

/* ===[ Thumbnails ]=== */

.rs-thumb-wrap { *zoom: 1 }

   .rs-thumb-wrap > a {
       display: block;
       float: left;
       position: relative;
       -moz-box-sizing: border-box;
       -webkit-box-sizing: border-box;
       box-sizing: border-box;
       -webkit-backface-visibility: hidden; /* Hardware accelerate to prevent jumps on transition */
   }
       .rs-thumb-wrap > a > img {
           max-width: 100%;
           max-height: 100%;
           display: block;
           -ms-interpolation-mode: bicubic;
       }

.rs-thumb-wrap > a:first-child { margin-left: 0!important }

/* ===[ Arrows ]=== */

.rs-arrows .rs-next, .rs-arrows .rs-prev { z-index: 1; background-image: url("fancybox_sprite.png");}

.rs-arrows .rs-next, .rs-arrows .rs-prev { z-index: 1; background-image: url("fancybox_sprite.png");}

.rs-arrows:hover .rs-next, .rs-arrows:hover .rs-prev { z-index: 2; }

/* ===[ Captions ]=== */

.rs-caption {

   position: absolute;
   max-height: 100%;
   overflow: auto;
   -moz-box-sizing: border-box;
   -webkit-box-sizing: border-box;
   box-sizing: border-box;
   bottom: 0;
   left: 0;

}

.rs-caption.rs-top-left {

   top: 0;
   bottom: auto;

}

.rs-caption.rs-top-right {

   top: 0;
   right: 0;
   left: auto;
   bottom: auto;

}

.rs-caption.rs-bottom-left {

   bottom: 0;
   left: 0;

}

.rs-caption.rs-bottom-right {

   right: 0;
   left: auto;
   border-bottom: none;
   border-right: none;

}

.rs-caption.rs-top {

   top: 0;
   bottom: auto;
   width: 100%!important;

}

.rs-caption.rs-bottom { width: 100%!important }

.rs-caption.rs-left {

   top: 0;
   height: 100%;

}

.rs-caption.rs-right {

   top: 0;
   left: auto;
   right: 0;
   height: 100%;

}

/* ===[ Grid ]=== */

.rs-grid {

   position: absolute;
   overflow: hidden;
   width: 100%;
   height: 100%;
   display: none;

}

.rs-gridlet {

   position: absolute;
   opacity: 1;

}

/* Optional - remove captions at smaller screen widths @media screen and (max-width: 480px) { .rs-caption { opacity: 0!important; } }

  • /

.project_box > img {

   margin-left: 90px;

}


  1. protocols, #polymers_protocols, #origami_protocols, #reaction_protocols, #nanocontainer_protocols, #imaging_protocols {
   font-size: 20px;
   font-weight: 300;
   margin-bottom: 30px;
   margin-left: 50px;

}


  1. protocols > h2, #polymers_protocols > h2, #origami_protocols > h2, #reaction_protocols > h2, #nanocontainer_protocols > h2, #imaging_protocols > h2 {
   margin-bottom: 20px;
   margin-top: 20px;

}


  1. protocols .interlude, #polymers_protocols .interlude, #origami_protocols .interlude, #reaction_protocols .interlude, #nanocontainer_protocols .interlude, #imaging_protocols .interlude {
   margin-left: -50px !important;

}


  1. protocols > ul {
   margin-bottom: 30px;
   margin-left: 30px;
   margin-top: 20px;

}

li > ul {

   margin-left: 10px;

}

/*achievement*/

.achievement_box{ background: none repeat scroll 0 0 #FFFFFF;

   color: #000000;
   display: block;
   float: left;
   font-size: 18px;
   font-weight: 300;
   line-height: 1.6;
   margin-left: 180px;
   margin-right: auto;
   overflow: hidden;
   padding: 10px;
   width: 50%;

}

  1. subnav-sticky-wrapper {
   height: 5px !important;

}

table {

   border-collapse: collapse;
   margin: auto auto 40px;
   width: 635px;;

} th {

   background-color: #5F5F5F;
   border: 1px solid #999999;
   color: #FFFFFF;

} tr td {

   border: 1px solid #999999;
   text-align: center;

} tr.odd td {

   background-color: #EEEEEE;
   color: #000000;

} .ref li {

   font-size: 14px;
   font-weight: 300;

} </style> <link href="http://openwetware.org/images/2/29/Nano_icon.png" rel="shortcut icon">


<script src="https://biomod2013.googlecode.com/svn/trunk/js/jquery.isotope.min.js"></script> <script src="https://biomod2013.googlecode.com/svn/trunk/js/jquery.refineslide.min.js"></script>

 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/jquery.fancybox.pack.js"></script>
 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/helpers/jquery.fancybox-buttons.js"></script>
 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/helpers/jquery.fancybox-media.js"></script>
 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/helpers/jquery.fancybox-thumbs.js"></script>
 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.easing.min.js"></script>
 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.scrollUp.min.js"></script>


 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.stellar.min.js"></script>
 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.sticky.js"></script>
 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.scrollTo.min.js"></script>
 <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.localscroll.min.js"></script>

<script>

 (function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){
 (i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o),
 m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m)
 })(window,document,'script','//www.google-analytics.com/analytics.js','ga');
 ga('create', 'UA-45176973-1', 'openwetware.org');
 ga('send', 'pageview');

</script>

<style type="text/css"> /*! fancyBox v2.1.5 fancyapps.com | fancyapps.com/fancybox/#license */ .fancybox-wrap, .fancybox-skin, .fancybox-outer, .fancybox-inner, .fancybox-image, .fancybox-wrap iframe, .fancybox-wrap object, .fancybox-nav, .fancybox-nav span, .fancybox-tmp { padding: 0; margin: 0; border: 0; outline: none; vertical-align: top; }

.fancybox-wrap { position: absolute; top: 0; left: 0; z-index: 8020; }

.fancybox-skin { position: relative; background: #f9f9f9; color: #444; text-shadow: none; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; }

.fancybox-opened { z-index: 8030; }

.fancybox-opened .fancybox-skin { -webkit-box-shadow: 0 10px 25px rgba(0, 0, 0, 0.5); -moz-box-shadow: 0 10px 25px rgba(0, 0, 0, 0.5); box-shadow: 0 10px 25px rgba(0, 0, 0, 0.5); }

.fancybox-outer, .fancybox-inner { position: relative; }

.fancybox-inner { overflow: hidden; }

.fancybox-type-iframe .fancybox-inner { -webkit-overflow-scrolling: touch; }

.fancybox-error { color: #444; font: 14px/20px "Helvetica Neue",Helvetica,Arial,sans-serif; margin: 0; padding: 15px; white-space: nowrap; }

.fancybox-image, .fancybox-iframe { display: block; width: 100%; height: 100%; }

.fancybox-image { max-width: 100%; max-height: 100%; }

  1. fancybox-loading, .fancybox-close, .fancybox-prev span, .fancybox-next span {

background-image: url('http://openwetware.org/images/5/55/Fancybox_sprite.png'); }

  1. fancybox-loading {

position: fixed; top: 50%; left: 50%; margin-top: -22px; margin-left: -22px; background-position: 0 -108px; opacity: 0.8; cursor: pointer; z-index: 8060; }

  1. fancybox-loading div {

width: 44px; height: 44px; background: url('http://openwetware.org/images/d/d0/Fancybox_loading.gif') center center no-repeat; }

.fancybox-close { position: absolute; top: -18px; right: -18px; width: 36px; height: 36px; cursor: pointer; z-index: 8040; }

.fancybox-nav { position: absolute; top: 0; width: 40%; height: 100%; cursor: pointer; text-decoration: none; background: transparent url('http://openwetware.org/images/c/c0/Blank.gif'); /* helps IE */ -webkit-tap-highlight-color: rgba(0,0,0,0); z-index: 8040; }

.fancybox-prev { left: 0; }

.fancybox-next { right: 0; }

.fancybox-nav span { position: absolute; top: 50%; width: 36px; height: 34px; margin-top: -18px; cursor: pointer; z-index: 8040; visibility: hidden; }

.fancybox-prev span { left: 10px; background-position: 0 -36px; }

.fancybox-next span { right: 10px; background-position: 0 -72px; }

.fancybox-nav:hover span { visibility: visible; }

.fancybox-tmp { position: absolute; top: -99999px; left: -99999px; visibility: hidden; max-width: 99999px; max-height: 99999px; overflow: visible !important; }

/* Overlay helper */

.fancybox-lock {

   overflow: hidden !important;
   width: auto;

}

.fancybox-lock body {

   overflow: hidden !important;

}

.fancybox-lock-test {

   overflow-y: hidden !important;

}

.fancybox-overlay { position: absolute; top: 0; left: 0; overflow: hidden; display: none; z-index: 8010; background: url('http://openwetware.org/images/e/e0/Fancybox_overlay.png'); }

.fancybox-overlay-fixed { position: fixed; bottom: 0; right: 0; }

.fancybox-lock .fancybox-overlay { overflow: auto; overflow-y: scroll; }

/* Title helper */

.fancybox-title { visibility: hidden; font: normal 13px/20px "Helvetica Neue",Helvetica,Arial,sans-serif; position: relative; text-shadow: none; z-index: 8050; }

.fancybox-opened .fancybox-title { visibility: visible; }

.fancybox-title-float-wrap { position: absolute; bottom: 0; right: 50%; margin-bottom: -35px; z-index: 8050; text-align: center; }

.fancybox-title-float-wrap .child { display: inline-block; margin-right: -100%; padding: 2px 20px; background: transparent; /* Fallback for web browsers that doesn't support RGBa */ background: rgba(0, 0, 0, 0.8); -webkit-border-radius: 15px; -moz-border-radius: 15px; border-radius: 15px; text-shadow: 0 1px 2px #222; color: #FFF; font-weight: bold; line-height: 24px; white-space: nowrap; }

.fancybox-title-outside-wrap { position: relative; margin-top: 10px; color: #fff; }

.fancybox-title-inside-wrap { padding-top: 10px; }

.fancybox-title-over-wrap { position: absolute; bottom: 0; left: 0; color: #fff; padding: 10px; background: #000; background: rgba(0, 0, 0, .8); }

/*Retina graphics!*/ @media only screen and (-webkit-min-device-pixel-ratio: 1.5), only screen and (min--moz-device-pixel-ratio: 1.5), only screen and (min-device-pixel-ratio: 1.5){

#fancybox-loading, .fancybox-close, .fancybox-prev span, .fancybox-next span { background-image: url('http://openwetware.org/images/b/b8/Fancybox_sprite%402x.png'); background-size: 44px 152px; /*The size of the normal image, half the size of the hi-res image*/ }

#fancybox-loading div { background-image: url('http://openwetware.org/images/0/01/Fancybox_loading%402x.gif'); background-size: 24px 24px; /*The size of the normal image, half the size of the hi-res image*/ } }

  1. fancybox-buttons {

position: fixed; left: 0; width: 100%; z-index: 8050; }

  1. fancybox-buttons.top {

top: 10px; }

  1. fancybox-buttons.bottom {

bottom: 10px; }

  1. fancybox-buttons ul {

display: block; width: 166px; height: 30px; margin: 0 auto; padding: 0; list-style: none; border: 1px solid #111; border-radius: 3px; -webkit-box-shadow: inset 0 0 0 1px rgba(255,255,255,.05); -moz-box-shadow: inset 0 0 0 1px rgba(255,255,255,.05); box-shadow: inset 0 0 0 1px rgba(255,255,255,.05); background: rgb(50,50,50); background: -moz-linear-gradient(top, rgb(68,68,68) 0%, rgb(52,52,52) 50%, rgb(41,41,41) 50%, rgb(51,51,51) 100%); background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,rgb(68,68,68)), color-stop(50%,rgb(52,52,52)), color-stop(50%,rgb(41,41,41)), color-stop(100%,rgb(51,51,51))); background: -webkit-linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%); background: -o-linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%); background: -ms-linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%); background: linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%); filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#444444', endColorstr='#222222',GradientType=0 ); }

  1. fancybox-buttons ul li {

float: left; margin: 0; padding: 0; }

  1. fancybox-buttons a {

display: block; width: 30px; height: 30px; text-indent: -9999px; background-color: transparent; background-image: url('fancybox_buttons.png'); background-repeat: no-repeat; outline: none; opacity: 0.8; }

  1. fancybox-buttons a:hover {

opacity: 1; }

  1. fancybox-buttons a.btnPrev {

background-position: 5px 0; }

  1. fancybox-buttons a.btnNext {

background-position: -33px 0; border-right: 1px solid #3e3e3e; }

  1. fancybox-buttons a.btnPlay {

background-position: 0 -30px; }

  1. fancybox-buttons a.btnPlayOn {

background-position: -30px -30px; }

  1. fancybox-buttons a.btnToggle {

background-position: 3px -60px; border-left: 1px solid #111; border-right: 1px solid #3e3e3e; width: 35px }

  1. fancybox-buttons a.btnToggleOn {

background-position: -27px -60px; }

  1. fancybox-buttons a.btnClose {

border-left: 1px solid #111; width: 35px; background-position: -56px 0px; }

  1. fancybox-buttons a.btnDisabled {

opacity : 0.4; cursor: default; }

  1. fancybox-thumbs {

position: fixed; left: 0; width: 100%; overflow: hidden; z-index: 8050; }

  1. fancybox-thumbs.bottom {

bottom: 2px; }

  1. fancybox-thumbs.top {

top: 2px; }

  1. fancybox-thumbs ul {

position: relative; list-style: none; margin: 0; padding: 0; }

  1. fancybox-thumbs ul li {

float: left; padding: 1px; opacity: 0.5; }

  1. fancybox-thumbs ul li.active {

opacity: 0.75; padding: 0; border: 1px solid #fff; }

  1. fancybox-thumbs ul li:hover {

opacity: 1; }

  1. fancybox-thumbs ul li a {

display: block; position: relative; overflow: hidden; border: 1px solid #222; background: #111; outline: none; }

  1. fancybox-thumbs ul li img {

display: block; position: relative; border: 0; padding: 0; max-width: none; } p.serif {

   font-family: "Times New Roman", Times, serif;

} .box.b1x3{ width: 853px;

      height: 465px;

}

  1. b2x2

{ position:fixed; }

  1. main-nav {
   width: 100%;
   height: 67px;
   background: #f2f2f2;

}

  1. main-nav .subnav {
   display: none;
   position: absolute;
   top: 67px;
   left: 0px;
   right:0px;
   width: 100%;
   list-style-type: none;
   background: #f2f2f2;
   margin: 0;
   border:solid 1px #eeeeee;
   z-index:5;
   padding:0;

}

  1. main-nav .subnav li {
   display: block;
   border-bottom: solid 1px #580000;
   margin:0;

}

  1. main-nav .subnav li a {
   color: #333;
   height:18px;
  
   font-size:20px;

}

  1. main-nav .subnav li a:hover {
   background:#f9f9f9;

}

  1. nav-primary {
   list-style-type: none;
   margin: 0;
   float: left;
   padding:0;

}

  1. nav-primary li {
   float: left;
   position: relative;

}

  1. nav-primary li a {
   float: left;
   color: #000;
   text-align: center;
   font-size: 20px;
   height: 40px;
   padding-top: 35px;
   line-height: 13px;
   width:120px;
   text-decoration:none;

}

  1. nav-primary li a:hover {
   text-decoration:none;
   color:#FFCC00;

}

  1. nav-primary li:hover .subnav {
   display: block;

} </style>

</p><p> <section id="content"> <nav id = "main-nav"> <ul id="nav-primary" > <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU"><i class="menu-icon icon-team"></i><span>Main</span></a></li> <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Project"><i class="menu-icon icon-team"></i><span>Project</span></a></li> <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Design"><i class="menu-icon icon-studio"></i><span>Design</span></a></li> <li class = "selected"><a href="#"><i class="menu-icon icon-studio"></i><span>Experiment</span></a>

                                <ul class = "subnav">
                                      <li><a href = "http://openwetware.org/wiki/Biomod/2014/ASU/Materials"><span>Materials</span></a></li>
                                      <li><a href = "http://openwetware.org/wiki/Biomod/2014/ASU/Protocols"><span>Protocols</span></a></li>
                                </ul></li>
                       <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Results"><i class="menu-icon icon-studio"></i><span>Results</span></a></li>
                       <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Discussion"><i class="menu-icon icon-studio"></i><span>Discussion</span></a></li>

<li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Team"><i class="menu-icon icon-studio"></i><span>Team</span></a></li>

                       <li><a href="http://openwetware.org/wiki/Biomod/2014/ASU/Acknowledgement"><i class="menu-icon icon-studio"></i><span>Acknowledgements</span></a></li>	

</ul> </nav>

        <div id="container" class="clearfix">
               
    <div id = "b2x2">
               <div class="box b2x2 tease" data-symbol="intro" data-category="student">
                       <img src = "http://openwetware.org/images/1/1b/Rsz_ascube.png">
               </div>
     </div>
        <div class="box b1x2" data-symbol="description" data-category="student">

<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Tile Assembly</span></p>

                      <hr>

<p style = "color: #000000; font-size: 16px;"><b>· buffer stock (10x TAE/Mg2+)</b></p> <p style = "color: #000000; font-size: 16px;"><b>· ssDNA strand stocks</b></p><br> <img src = "http://openwetware.org/images/0/05/Screen_Shot_2014-10-25_at_10.18.42_PM.png"> <img src = "http://openwetware.org/images/9/9f/Screen_Shot_2014-10-25_at_10.19.40_PM.png"> <img src = "http://openwetware.org/images/a/ae/Screen_Shot_2014-10-25_at_10.20.50_PM.png"> <img src = "http://openwetware.org/images/1/19/Screen_Shot_2014-10-25_at_10.21.48_PM.png"> <br> <p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Gel Electrophoresis (PAGE)</span></p>

                      <hr>

<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· 40% acrylamide</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· water</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· 10x TAE/Mg2+ + 1M KCl buffer</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Ammonium persulfate (APS)</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Tetramethylethylenediamine (TEMED)</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· SYBR Green gel stain</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Native dye</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; - 0.2% bromophenol blue</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; - 0.2% xylene cyanole</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; - 5% glycerol</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; - in 1x TAE/Mg2+ buffered solution</p><br>


<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Gel electrophoresis (Agarose)</span></p>

                      <hr>

<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Agarose powder</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· water</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· SYBR Safe</p><br>


<p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">PCR</span></p>

                      <hr>

<p style = "color: #000000; font-size: 16px;text-decoration:underline;">New England Biolabs PCR kit:</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Phusion High-Fidelity DNA polymerase</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· 10 mM dNTPs</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· DMSO</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· 5x Phusion buffer</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Affinity column preparations:</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· NHS ester beads</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· PCR Buffer</p><br> <p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Affinity Column Preparation</span></p>

                      <hr>

<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· NHS modified agarose beads</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Coupling buffer: HEPES 100 mM, pH 7.2, 150 mM NaCl</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Quenching buffer: 1 M Tris, pH 7.4</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Binding buffer: 1x TAE Mg2+, 100 mM KCl</p><br> <p class = "serif" style = "color: #000000; font-size: 25px;"><span class = "mw-headline">Computer Simulation</span></p>

                      <hr>          

<p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· CaDNAno</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Cando</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· PyMol</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Chimera</p> <p style = "color: #000000; font-size: 16px;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;· Avogadro</p><br>

</div>

 <script>
   $(function(){
     var $container = $('#container');
     $container.isotope({
       itemSelector : '.box',
               columnWidth: 220,
               sortBy : 'random',
               gutterWidth: 8,
               cornerStampSelector: '.logo',
               category : function( $elem ) {
                               return $elem.attr('data-category');
                       },
               sortBy: 'category'
     });



   });
 </script>

<script>

$(function () { $('.rs-slider').refineSlide({ transition  : 'fade', useThumbs  : false, autoplay: false, maxWidth: 460, onInit : function () { var slider = this.slider; $('.next').on('click', function (e) { e.preventDefault(); slider.next() }); $('.prev').on('click', function (e) { e.preventDefault(); slider.prev() });

} }); }); </script> <script> $(document).ready(function() { $(".yt").fancybox({ maxWidth : 800, maxHeight : 600, fitToView : false, width : '70%', height : '70%', autoSize : false, closeClick : false, openEffect : 'none', closeEffect : 'none' }); }); </script>

 </section>

</p> <!-- NewPP limit report Preprocessor node count: 14/1000000 Post-expand include size: 82/2097152 bytes Template argument size: 0/2097152 bytes Expensive parser function count: 0/100 -->

<!-- Saved in parser cache with key owwdb:pcache:idhash:136275-0!1!0!!en!2!edit=0 and timestamp 20141003222942 --> <div class="printfooter"> Retrieved from "<a href="http://openwetware.org/wiki/Biomod/2014/ASU">http://openwetware.org/wiki/Biomod/2014/ASU</a>"</div> <!-- end content --> <div class="visualClear"></div> </div> </div> </div>


<div id="column-one"> <div id="p-cactions" class="portlet"> <h5>Views</h5> <div class="pBody"> <ul> <li id="ca-nstab-main" class="selected"><a href="/wiki/Biomod/2014/ASU" title="View the content page [c]" accesskey="c">Page</a></li> <li id="ca-talk" class="new"><a href="/index.php?title=Talk:Biomod/2014/ASU&amp;action=edit" title="Discussion about the content page [t]" accesskey="t">Talk</a></li> <li id="ca-viewsource"><a href="/index.php?title=Biomod/2014/ASU&amp;action=edit" title="This page is protected.&#10;You can view its source. [e]" accesskey="e">View source</a></li> <li id="ca-history"><a href="/index.php?title=Biomod/2014/ASU&amp;action=history" title="Past versions of this page. [h]" accesskey="h">History</a></li> </ul> </div> </div> <div class="portlet" id="p-personal"> <h5>Personal tools</h5> <div class="pBody"> <ul> <li id="pt-anonuserpage"><a href="/wiki/User:209.147.144.5" title="The user page for the ip you&#039;re editing as [.]" accesskey="." class="new">209.147.144.5</a></li> <li id="pt-anontalk"><a href="/wiki/User_talk:209.147.144.5" title="Discussion about edits from this ip address [n]" accesskey="n" class="new">Talk for this IP</a></li> <li id="pt-anonlogin"><a href="/index.php?title=Special:UserLogin&amp;returnto=Biomod/2014/ASU" title="You are encouraged to log in, it is not mandatory however. [o]" accesskey="o">Log in</a></li> </ul> </div> </div>

<div id="sidebar-main"> <div class="portlet" id="p-logo"> <a style="background-image: url(/OWWEmblem2.png);" href="/wiki/Main_Page" title="Visit the Main Page [z]" accesskey="z"></a> </div> <script type="text/javascript"> if (window.isMSIE55) fixalpha(); </script> <div class='portlet' id='p-navigation'> <h5>Navigation</h5> <div class='pBody'> <ul> <li id="n-mainpage"><a href="/wiki/Main_Page" title="Visit the Main Page [z]" accesskey="z">Main Page</a></li> <li id="n-recentchanges"><a href="/wiki/Special:RecentChanges" title="The list of recent changes in the wiki. [r]" accesskey="r">Recent changes</a></li> <li id="n-help"><a href="/wiki/Help:Contents" title="The place to find out.">Help</a></li> <li id="n-contactoww"><a href="/wiki/Special:Contact">Contact OWW</a></li> <li id="n-ocnotebook"><a href="/wiki/Help:Notebook/One_Click_Setup">Add a Lab Notebook</a></li> </ul> </div> </div> <div class='portlet' id='p-research'> <h5>research</h5> <div class='pBody'> <ul> <li id="n-Materials"><a href="/wiki/Materials">Materials</a></li> <li id="n-Protocols"><a href="/wiki/Protocols">Protocols</a></li> <li id="n-Resources"><a href="/wiki/Resources">Resources</a></li> </ul> </div> </div>

<div id="p-search" class="portlet testing"> <h5><label for="searchInput">Search</label></h5> <div id="searchBody" class="pBody"> <form action="/wiki/Special:Search" id="searchform"><div> <input id="searchInput" name="search" type="text" title="Search OpenWetWare [f]" accesskey="f" value="" /> <input type='submit' name="googlefulltext" class="searchButton" id="mw-googleSearchButton" value="Search" title="Google search of OpenWetWare for this text" /> <input type='submit' name="go" class="searchButton" id="searchGoButton" value="Go" title="Go to a page with this exact name if exists" />&nbsp; <a href="/wiki/Help:Search"><img title="Click here for help on OWW Search features" src="/images/7/70/Random.png" alt="Help" /></a> </div></form> </div> </div> <div class="portlet" id="p-tb"> <h5>Toolbox</h5> <div class="pBody"> <ul> <li id="t-whatlinkshere"><a href="/wiki/Special:WhatLinksHere/Biomod/2014/ASU" title="List of all wiki pages that link here [j]" accesskey="j">What links here</a></li> <li id="t-recentchangeslinked"><a href="/wiki/Special:RecentChangesLinked/Biomod/2014/ASU" title="Recent changes in pages linked from this page [k]" accesskey="k">Related changes</a></li> <li id="t-upload"><a href="/wiki/Special:Upload" title="Upload files [u]" accesskey="u">Upload file</a></li> <li id="t-specialpages"><a href="/wiki/Special:SpecialPages" title="List of all special pages [q]" accesskey="q">Special pages</a></li> <li id="t-print"><a href="/index.php?title=Biomod/2014/ASU&amp;printable=yes" title="Printable version of this page [p]" accesskey="p">Printable version</a></li> <li id="t-permalink"><a href="/index.php?title=Biomod/2014/ASU&amp;oldid=750826" title="Permanent link to this version of the page">Permanent link</a></li><li id="t-cite"><a href="/index.php?title=Special:Cite&amp;page=Biomod/2014/ASU&amp;id=750826">Cite this page</a></li><li id="t-pdf"><a href="/wiki/Special:CategorySubscriptions/Biomod/2014/ASU">Subscribe to Categories</a></li> </ul> </div> </div> <div class="portlet" id="p-authorlist"> <h5>Contributing Authors</h5> <div class="pBody"> <ul> <li class="t-authorlink"><a href = "http://openwetware.org/wiki/User:Lucas_Schirmer" title="Original Author: Lucas Schirmer (31 Edits)"><b>Lucas Schirmer</b></a> </li> <li class="t-authorlink"><a href = "http://openwetware.org/wiki/User:ROBIN_ABRAHAM_Nadar" title="Contributing Author: ROBIN ABRAHAM Nadar (11 Edits)">ROBIN ABRAHAM Nadar</a> </li> </ul> </div> </div>

       <div id="p-join" class="portlet">
               <div align="center">
                       <a href="/wiki/OpenWetWare:How_to_join">

<img style="margin:2px;" src="http://openwetware.org/images/0/03/88x31_JoinOWW.png" border=0 /></a>

               </div>
       </div>

</div>

</div><!-- end of the left column -->


<div class="visualClear"></div> <div id="footer"> <div id="f-poweredbyico"><a href="http://www.mediawiki.org/"><img src="/skins/common/images/poweredby_mediawiki_88x31.png" alt="Powered by MediaWiki" /></a></div> <div id="f-copyrightico"><a href="http://creativecommons.org/licenses/by-sa/2.5/"><img src="/somerights20.png" alt='GNU FDL or Creative Commons BY-SA' /></a></div> <ul id="f-list">


<li id="copyright">Content is available under <a href="/wiki/Copyright" title="Copyright">GNU FDL or Creative Commons BY-SA</a>.</li> <li id="privacy"><a href="/wiki/OpenWetWare:Privacy_policy" title="OpenWetWare:Privacy policy">Privacy policy</a></li> <li id="about"><a href="/wiki/OpenWetWare:About" title="OpenWetWare:About">About OpenWetWare</a></li> <li id="disclaimer"><a href="/wiki/OpenWetWare:General_disclaimer" title="OpenWetWare:General disclaimer">Disclaimers</a></li>

</ul> </div>


<script type="text/javascript">if (window.runOnloadHook) runOnloadHook();</script>

<script src="/js/Urchin/urchin.js" type="text/javascript"> </script> <script type="text/javascript"> _uacct = "UA-2860391-2"; urchinTracker(); </script> </div> <!-- Served in 0.468 secs. --><!-- add a little something for the spambots out there... --> <!-- The comment tags around the url *ARE* intentional --> <!-- <a href="http://openwetware.org/ferry.php">concatenate-federal</a> --> </body></html>